Elongator complex protein 1 ELP1 Antibody Biotin citations for Becton, Dickinson and Company

Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...

A Versatile Oblique Plane Microscope for Large-Scale and High-Resolution Imaging of Subcellular Dynamics

Etai Sapoznik, et al., bioRxiv - Biophysics 2020

Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...

Respiratory Syncytial virus NS1 protein targets the transactivator binding domain of MED25

Vincent Basse, et al., bioRxiv - Microbiology 2021

Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...

Human Lung-resident Mucosal-Associated Invariant T cells are Abundant, Express Antimicrobial Proteins, and are Cytokine Responsive

Erin W. Meermeier, et al., bioRxiv - Immunology 2022

Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...

Targeting tau mitigates mitochondrial fragmentation and oxidative stress in amyotrophic lateral sclerosis

Tiziana Petrozziello, et al., bioRxiv - Neuroscience 2021

Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...

The peroxisomal exportomer directly inhibits phosphoactivation of the pexophagy receptor Atg36 to suppress pexophagy in yeast

Houqing Yu, Roarke A. Kamber, Vladimir Denic, bioRxiv - Molecular Biology 2021

Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...

Induction of selective cell death in HIV-1-infected cells by DDX3 inhibitors leads to depletion of the inducible reservoir

Shringar Rao, et al., bioRxiv - Microbiology 2021

Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...

The Fe-S cluster assembly factors NFU4 and NFU5 are primarily required for protein lipoylation in mitochondria

Jonathan Przybyla-Toscano, et al., bioRxiv - Plant Biology 2021

Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...

A recombinant SARS-CoV-2 RBD antigen expressed in insect cells elicits immunogenicity and confirms safety in animal models

Ricardo Choque-Guevara, et al., bioRxiv - Immunology 2021

Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...

Acute inflammation, mediated by lung neutrophils, confers enhanced protection against Mycobacterium tuberculosis infection in mice

Tucker J. Piergallini, et al., bioRxiv - Immunology 2021

Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...

IL-12 signaling promotes TET2-mediated DNA demethylation during CD8 T cell effector differentiation

Caitlin C. Zebley, et al., bioRxiv - Immunology 2020

Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).

TCR affinity controls the dynamics but not the functional specification of the Th1 response to mycobacteria

Nayan D Bhattacharyya, et al., bioRxiv - Immunology 2020

Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)

N-acetyltransferase 10-mediated mRNA N4-acetylation is Essential for the Translational Regulation During Oocyte Meiotic Maturation in Mice

Lu Chen, et al., bioRxiv - Developmental Biology 2024

Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...

Methylmalonic acid induces metabolic abnormalities and exhaustion in CD8⁺ T cells to suppress anti-tumor immunity

Joanne D. Tejero, et al., bioRxiv - Immunology 2024

Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...

The structure of the R2T complex reveals a different architecture of the related HSP90 co-chaperones R2T and R2TP

Alberto Palacios-Abella, et al., bioRxiv - Biochemistry 2024

Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...

Induction of immortal-like and functional CAR-T cells by defined factors

Lixia Wang, et al., bioRxiv - Immunology 2023

Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...

Multifaceted B-cell response to transient HIV viraemia in elite controllers

Luke Muir, et al., bioRxiv - Immunology 2024

Quote: ... To generate fluorescently tagged Env probes 2 μg of biotinylated Env protein was incubated with either 0.5 μg streptavidin-conjugated PE (BD Biosciences) or 0.5 μg streptavidin-conjugated BV786 (BD Biosciences ...

An in-vitro BBB-on-a-chip open model of human blood-brain barrier enabling advanced optical imaging

Mootaz Salman, et al., bioRxiv - Bioengineering 2020

Quote: ... at 5:1:1 concentration ratio before transferred into a 1 ml syringe with BD Luer-Lok (BD, 309628, NJ, USA). The syringe was then hanged vertically to allow cell settling by gravity for 10-15 min with no flow ...

Environmental and taxonomic drivers of bacterial extracellular vesicle production in marine ecosystems

Steven J. Biller, et al., bioRxiv - Microbiology 2022

Quote: ... were grown in in Pro99 media supplemented with 5 g L-1 peptone and 1 g L-1 yeast extract (BD Difco). All heterotrophs were grown at 24 °C ...

Labshake search