Labshake search
Citations for Becton, Dickinson and Company :
2801 - 2850 of 9171 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... single colonies were inoculated into 3 ml Tryptic Soy Broth (TSB, BD) with 10 µg/ml chloramphenicol (Cm10 ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed using FCAP Array software v.3 (BD Biosciences).
-
bioRxiv - Cell Biology 2024Quote: ... then sort-matched for GFP using a FACSMelody 3-laser sorter (BD).
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were stained with an activated caspase-3 antibody (BD Biosciences, anti:Rabbit) to mark apoptotic cells ...
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Biophysics 2024Quote: ... sealed at the other end by a 0.6x30mm needle (BD, microlance 3) attached to a 3mL syringe (Braun ...
-
bioRxiv - Immunology 2021Quote: ... for 4 h in presence of Golgi Plug (BD Pharmingen). For CD4+T cells isolation from spleen ...
-
bioRxiv - Immunology 2022Quote: ... TCR Vβ5.1/5.2-PE (BD Bioscience: 562088, clone: MR9-4), TCR Vβ6-BV421 (BD Bioscience ...
-
bioRxiv - Bioengineering 2020Quote: ... they were analyzed using a Fortessa 4-15 (BD Biosciences) with a High Throughput Screening module.
-
bioRxiv - Neuroscience 2021Quote: ... Ly-6C (clone 1A8, BV510, 4 µg/ml, BD Biosciences), F4/80 (clone BM-8 ...
-
bioRxiv - Pathology 2021Quote: ... MHC II (anti-mouse, clone 14- 4-4S, BD Biosciences), and a Live/Dead discriminator (Fixable Near-IR Dead Cell Stain Kit ...
-
bioRxiv - Immunology 2019Quote: ... for 4 hours with addition of Monensin (Golgistop, BD Bioscience) during the last 3.5 hours at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... 4°C with Brilliant Violet Buffer (BD Biosciences, Cat# 566349) at 1/4 in PBS-FBS 1% (see Supplemental Table 3 for antibody staining panel).
-
bioRxiv - Immunology 2020Quote: ... CD4-PerCP-Cy5.5 mAb (clone 74-12-4, BD Bioscience) and CD8β-FITC mAb (clone PPT23 ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... and CD184/CXCR-4-BIOTIN (BD Biosciences [Lot 6336587; 551968]). Cells were then washed ...
-
bioRxiv - Immunology 2020Quote: ... at 4 °C before flow cytometry on a FacsCanto (BD). Data was analyzed using FlowJo software (Version 10 ...
-
bioRxiv - Immunology 2021Quote: ... fixed for 10 mins in 4% formaldehyde (BD Biosciences Cytofix), washed in PBS and acquired on a BD FACSCelesta Cell Analyzer ...
-
bioRxiv - Immunology 2021Quote: Blood was obtained in 4 ml EDTA tubes (BD Biosciences). Absolute counts of total monocytes in whole blood were obtained using trucount beads (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... with soluble anti-CD28 (CD28.2, 4 μg/ml; BD Biosciences). Dynabead-activated cells were magnetically de-beaded immediately prior to electroporation ...
-
bioRxiv - Immunology 2021Quote: ... from Invitrogen and IL-4 (11B11) and IFN-γ (XMG1.2) from BD. Cells were analysed on LSR II flow cytometer (BD) ...
-
bioRxiv - Immunology 2020Quote: ... PE conjugated anti-monkey IL-4 (8D4-8, BD, 551774), and PE conjugated anti-monkey TNF-a (MAb11 ...
-
bioRxiv - Immunology 2020Quote: ... CD4-PerCP-Cy5.5 mAb (clone 74-12-4, BD Bioscience) and CD8α-PE mAb (clone 76-2-11 ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of GolgiStop (4 μl/6mL; BD Biosciences) for 3-4 hours ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 4 mg/ml Mycobaterium tuberculosis H37Ra (BD Difco) and 200 μg MOG35-55 peptide (MEVGWYRSPFSRVVHLYRNGK ...
-
bioRxiv - Immunology 2023Quote: ... following a 4 h treatment with Golgistop and Golgiplug (BD), cells were stained for analysis on day 4.
-
bioRxiv - Biochemistry 2023Quote: ... Anti-CD95L antibody (G247-4, #556387) was acquired from BD Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... Data were acquired on a LSRFortessa 4-15 (BD Biosciences), LSRFortessa X-20 (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... mice were administrated (i.p.) with 4% (v/v) thioglycollate (BD) for 4 h before sacrifice ...
-
bioRxiv - Cancer Biology 2024Quote: ... they were either fixed with 4% formaldehyde-containing buffer (BD) for thirty minutes or immediately stained for surface markers and then fixed ...
-
bioRxiv - Immunology 2021Quote: ... One million cells per sample were pre-incubated with purified anti-mouse CD16/CD32 antibody (Fc Block™, 553141, BD Biosciences). Live/dead cells were discriminated by staining cells with the LIVE/DEAD® Fixable Near-IR Dead Cell Stain kit (L10119 ...
-
bioRxiv - Immunology 2021Quote: ... 2000 cells of the CD45−CD31+CD146+ cell population were sorted into eppendorfs containing 125 μL PBS on one of the two available FACSAria™ II or III machines (BD). After sorting ...
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with one plasmid derived from pPC86 (GAL4-activation domain, AD (‘Prey’)) and pPC97 (GAL4-DNA-binding domain, BD (‘Bait’)) (Chevray and Nathans ...
-
bioRxiv - Immunology 2021Quote: ... lymphocytes were stained for one hour at room temperature in the dark with CD56-APC (Miltenyi) and CXCR4-PE (BD Biosciences) or CD3 APC-cy7 (Sony ...
-
bioRxiv - Cell Biology 2019Quote: Three thousand flow sorted DAPI-CD45-CD31-Epcam+GFP+ cells were cultured with one hundred thousand MLg mouse lung fibroblasts and Matrigel (BD Biosciences) seeded onto Transwell filter inserts (BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... one million cells were resuspended in FACS buffer and stained with Cd11b PE-Cy7 (BD 552850, clone M1/70, lot 0058856) and GR-1 (Ly-6G and Ly-6C ...
-
bioRxiv - Genomics 2020Quote: Immune cells for bulk mRNA sequencing were incubated with Fc Block for 20 minutes and then stained with one of six panels of directly conjugated antibodies for 30 minutes: anti-human CD16 (BD 558122), CD123 (BD 560826) ...
-
bioRxiv - Physiology 2022Quote: ... Cells were loaded into one BD Rhapsody™ Cartridge which was primed and treated strictly following the manufacturers protocol (BD Biosciences). Cell Capture Beads (BD Biosciences ...
-
bioRxiv - Molecular Biology 2022Quote: ... Thermo Fischer) for one hour at room temperature and co-stained with anti-γH2AX coupled to Alexa 647 (560447, BD Biosciences) and anit-mCherry coupled to Alexa 594 (M11240 ...
-
bioRxiv - Molecular Biology 2022Quote: ... blocked with Sea-block buffer (37527- Thermo Fischer) for one hour at room temperature and co-stained with Alexa 647-coupled mouse anti-γH2AX (560447, BD Biosciences) and FITC coupled goat anti-GFP (NB100-1771 ...
-
bioRxiv - Genomics 2024Quote: ... Three to five 96-well plates were seeded with one fluorescent cell per well using the BD FACSAriaTM II (BD Biosciences), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 48h post transfection cells were sorted for single cell clones by seeding one RFP- and GFP-positive cell per 96-well using a FACS Melody sorter (BD Bioscience). The deletion of IGF2BP1 was validated by western blotting ...
-
bioRxiv - Cancer Biology 2023Quote: ... We sorted single nuclei in 96-or 384-well plates (one nucleus per well in 10 nL sorting volume) using the BD FACSJazz Cell Sorter (BD Biosciences) based on forward and side scatter properties ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...