Labshake search
Citations for Becton, Dickinson and Company :
201 - 250 of 1308 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and treated with a Cytofix/Cytoperm kit (BD Biosciences) per manufacturer protocol.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Human IL-1β ELISA kit was obtained from BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: A human Th1/Th2/Th17 Cytokine Kit (BD Biosciences) was used to measure the production of cytokines as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... fixed/permeabalized using the BD cytofix/cytoperm kit (BD), and stained with anti-IFNγ (XMG1.2 ...
-
bioRxiv - Bioengineering 2022Quote: ... IFNγ and TNFα ELISA kit were purchased from BD Biosciences (San Jose ...
-
bioRxiv - Immunology 2022Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences) prior to acquisition using FACSymphony ...
-
bioRxiv - Immunology 2023Quote: ... by using Cytofix/CytoPerm Plus kit (555028; BD Pharmingen). Samples were analyzed using a Fortessa flow cytometer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using a Cytofix/Cytoperm solution kit (BD Biosciences), and intracellularly stained with anti-TNF-Alexa 700 (alone MAB11) ...
-
bioRxiv - Immunology 2023Quote: ... FITC-anti-BrdU (BD, BrdU flow kit, Cat#559619), Zombie Aqua fixable viability kit (BioLegend ...
-
bioRxiv - Immunology 2024Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences). Final flow cytometry gating strategy for SFCs and PBMCs shown in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed using BD Cytofix kit (BD #554655) following manufacturer’s instructions and acquired on analyzer within 3 days of fixation ...
-
bioRxiv - Microbiology 2024Quote: ... BD OptEIA™ Mouse TNF ELISA Kit (BD Biosciences) and Mouse IFN-beta DuoSet ELISA (R&D Systems ...
-
bioRxiv - Immunology 2024Quote: ... anti-c-Kit–Pacific Blue (clone 2B8, BD Bioscience), anti-Sca-1–PE-Cy7 (clone D7 ...
-
bioRxiv - Immunology 2024Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences), then stained with anti-IFN-γ ...
-
bioRxiv - Immunology 2024Quote: ... and BD Cytofix/Cytoperm Fix/Permeabilization kit (BD, 554714) were used ...
-
bioRxiv - Immunology 2024Quote: ... and BrdU with the FITC BrdU kit (BD Biosciences). DNA was stained with 7AAD prior to flow cytometric acquisition.
-
bioRxiv - Immunology 2024Quote: ... and staining using the Cytofix/Cytoperm kit (BD Biosciences). Antibodies included IFNγ (XMG1.2) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using the cDNA kit from BD. Libraries were prepared using the whole transcriptome analysis (WTA ...
-
bioRxiv - Immunology 2024Quote: ... and processed using BD Rhapsody Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Before fixation and permeabilization (BD Cytofix/Cytoperm kit, BDB554714), cells were washed once ...
-
bioRxiv - Bioengineering 2024Quote: ... and IFN-γ (BD OptiEIA Human IFN-γ kit) in the supernatant indicated the cell activation of Jurkat and NK-92 cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... respectively by BD Quantibrite Beads PE Fluorescence Quantitation Kit (BD Bioscience, #340495) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Immunology 2024Quote: ... a sample of bulk tank milk before vaccination was also collected and analysed by PCR and ELISA (CIVTEST Bovis BVD/BD p80; HIPRA) by an external laboratory ...
-
bioRxiv - Cancer Biology 2021Quote: Cell cycle analysis was performed using the BrdU Flow Kit according to the manufacturer protocol (BD, FITC BrdU Flow Kit; Cat. No. 559619), with cells pulsed with BrdU for 1 hour at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: pEU-E01 cell-free wheat germ expression vector containing ampicillin resistance and cell-free wheat germ expression kit (Cat# CFS-CPLE-BD Proteoliposome BD Kit) were obtained from CellFree Sciences Co. ...
-
bioRxiv - Cancer Biology 2024Quote: ... single cells of individual samples were labeled with sample tags (633781 BD Human Single-Cell Multiplexing Kit, 633793 BD Mouse Single-Cell Multiplexing Kit) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PE Annexin V Apoptosis Detection Kit II from BD Biosciences was used to detect apoptotic T cells according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2020Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Cancer Biology 2020Quote: ... the Apoptosis Detection Kit was used (BD Pharmingen, Bedford, USA), and cells were washed and resuspended in binding buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by mild fixation and permeabilization using the Cytofix and Cytoperm solutions from BD Cytofix/Cytoperm™ Fixation/ Permeabilization Solution Kit (BD biosciences, BDB554714) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then analyzed with BrdU-APC Flow Kit (BD Biosciences) as described previously (24).
-
bioRxiv - Molecular Biology 2021Quote: ... BD Cytofix/Cytoperm™ kit (BD Biosciences, San Jose, CA) was used following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... fixed and permeabilized using Fixation/Permeabilization Solution Kit (BD Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and stained using a PE BrdU flow kit (BD Biosciences). For coculture experiments and proliferation experiments ...
-
bioRxiv - Neuroscience 2021Quote: The cytokine bead array mouse inflammation kit (BD Biosciences, USA) was used for the determination of cytokine levels in brain lysate and plasma samples according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... followed by permeabilization with Cytofix/cytoperm kit solution (BD Biosciences) and staining with anti-IFN-γ (BD Biosciences Cat#554702) ...
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with the Cytofix/Cytoperm Kit (BD Biosciences), and stained for intracellular IFNγ using APC-XMG1.2 (eBioscience).
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with an intracellular cytokine staining kit (BD) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... permeabilized with cytofix/cytoperm Kit (BD Biosciences, Cat. no: 554714), and then stained with anti-Ki-67 antibody ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed using fixation solution (BD, FoxP3 staining kit) for 30 min and washed twice using FACS buffer ...
-
bioRxiv - Physiology 2021Quote: ... Annexin V-FITC apoptosis detection kit (BD Biosciences, 0076884, USA) was used to analyze hepatocyte apoptosis according to manufacturer’s protocol ...
-
bioRxiv - Pathology 2021Quote: The PE Annexin V Apoptosis detection kit I (BD, Germany) was used to analyze cell viability following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Infected cells were fixed with cytofix/cytoperm kit (BD Pharmingen) and stained using the indicated primary and secondary antibodies ...
-
bioRxiv - Immunology 2021Quote: ... and stained according to BD Cytofix/Cytoperm Kit (BD Biosciences) or the FoxP3/Transcription Factor Staining Buffer Set (Thermo Fisher).
-
bioRxiv - Immunology 2021Quote: ... fixed and were stained with Phosflow staining kit from BD Biosciences using manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Annexin V Apoptosis Detection Kit I (BD Bioscience, #559763) was used as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and processed using BD Rhapsody™ Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...