Labshake search
Citations for Becton, Dickinson and Company :
201 - 250 of 2969 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5 g yeast extract (Becton, Dickinson And Company), and 10 g NaCl per liter of water ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% skim milk (cat. #232100, BD) for 1 hour and incubated with appropriate antibody ...
-
bioRxiv - Immunology 2024Quote: ... biotinylated anti-mouse IL-5 (TRFK4, BD Biosciences); IL-13 ...
-
bioRxiv - Immunology 2024Quote: ... BV650 andi-CD64 (X54-5/7.1; BD Biosciences), BV711 anti-TNF (XP6-XT22 ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 g/L Bacto yeast extract (BD Biosciences), and 5 g/L NaCl ...
-
bioRxiv - Immunology 2021Quote: ... were resuspended in defRPMI-1640 with 3% newborn calf serum and Benzonase™ (FACS buffer) in 5 mL FACS tubes and pre-incubated with GolgiStop™ (BD Biosciences) for ∼60 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... 3 days after intraperitoneal injection of 2 mL of 3% thioglycollate medium (BD, Cat#: 211716), peritoneal macrophages were isolated and cultured in RPMI 1640 medium supplemented with 10% FBS (HyClone ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cell were resuspended in 200 μl of 2% KSR in PBS and analysed on a 5 laser LSR Fortessa analyser (BD Biosciences). Single cells were gated based on forward and side scatters ...
-
bioRxiv - Immunology 2021Quote: ... and chemokines (CXCL-10, CCL-2, CXCL-9, CXCL-8 and CCL-5) was quantified by specific cytometric bead arrays (BD Biosciences) on a FACS Canto (BD Biosciences ...
-
bioRxiv - Genetics 2020Quote: ... Cells were subsequently washed and resuspended with cold PBS supplemented with 5% FBS and stained with 2 mg/ml Propidium Iodide (BD Biosciences) at room temperature for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... lymphocytes were cultured in 96-well dishes at 37°C for 5-6 h in the presence of 2 μM peptide pool and brefeldin A (BD Biosciences). Cells were then labeled for cell-surface markers ...
-
bioRxiv - Microbiology 2021Quote: ... lymphocytes were cultured in 96-well dishes at 37°C for 5-6 h in the presence of 2 μM peptide pool and brefeldin A (BD Biosciences). Cells were then labeled for cell-surface markers ...
-
bioRxiv - Immunology 2021Quote: ... single MR1-5-OP-RU-tetramer+TRAV1-2+ PBMCs from healthy donors and spleen tissues were sorted using a FACSAria (BD Biosciences) into 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... prior to stimulation for 5 h with anti-CD3 and anti-CD28 without IL-2 in the presence of brefeldin A and monensin (BD Biosciences).
-
bioRxiv - Developmental Biology 2024Quote: ... 1 – 2 mL of thin albumin was aspirated out with a 5 mL syringe (Nipro) and a 18G sterile needle (BD PrecisionGlide) from the blunt end of the egg to create a space between the embryo and the shell ...
-
bioRxiv - Immunology 2024Quote: ... and WT littermate controls (n=5) were stained as described above with anti-CD3e FITC (clone 145–2 C11, BD Biosciences), anti-CD4 AF700 (RM4-5 ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated on ice for 5 min with rat anti-CD16/CD32 antibody (BD Biosciences, clone 2.4G2, 5 µg/ml) and Fixable Viability Dye eFluor 660 or UV455 (eBioscience ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell pellet was resuspended in 1 mL sterile PBS/5% FBS and transferred to a 5 mL flow cytometry tube via a 40 µm strainer cap (BD Falcon). Viability of the final samples was between 30-35% by trypan blue exclusion ...
-
bioRxiv - Bioengineering 2023Quote: ... pneumoniae serotype 3 (Sp3) (ATCC; Manassas, VA) was cultured on plates of BBL Trypticase Soy Agar with 5% sheep blood (BD Trypticase Soy Agar II) (BD Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Microbiology 2022Quote: ... 5 times with a 1 mL syringe (BD, Spain). This was the control sample.
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Immunology 2020Quote: ... CD38-FITC 1:5 (clone HIT2, BD Biosciences, 560982), and SARS-CoV-S1-CF647 at 1 µg/ml for patients CV07 ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Molecular Biology 2023Quote: ... resulting in five healthy postlarvae (1 to 5-BD) and five surviving diseased postlarvae (6 to 10-BD) ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD2 PE (clone RM2-5, BD Pharmingen, RRID: AB_2073810), CD5 PE (clone 53-7.3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:5 BD Horizon Brilliant Stain buffer (BD Biosciences), and 1:25 FcR blocking reagent (Miltenyi) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-CD4 (clone RM4-5, BD Bioscience, cat # BDB553043), anti-CD8 (clone 4SM15 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... After blocking with 5% nonfat milk (BD Biosciences, USA) for 2h ...