Labshake search
Citations for Becton, Dickinson and Company :
2351 - 2400 of 2472 citations for Recombinant Human TNFRSF18 Protein Fc Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... the sorted cell population was analyzed 1 hour after induction of protein expression by flow cytometry (Instrument: BD FACS-Aria SORP cell sorter ...
-
bioRxiv - Pathology 2022Quote: ... with allophycocyanin (APC) against B220 and with peridinin-chlorophyll proteins (PerCP-Cy™ 5.5) against CD45 from BD Pharmingen were diluted at 1/50 in PBS ...
-
bioRxiv - Immunology 2019Quote: ... HK Mtb or LPS (100 ng/mL) for 24h and the Golgi Plug protein transport inhibitor (BD Biosciences) was added for the last 6h according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins in the lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride membranes (BD Biosciences). The phosphorylation of the ERBBs and ERK was detected on the membranes with anti-pERBB1–B4 and anti-ppERK primary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% penicillin/streptomycin and 10 mM HEPES (pH 7.4) with 25% high-protein Matrigel (product 354248; BD Biosciences)) ...
-
bioRxiv - Genetics 2022Quote: ... Anti-RPA4 (1:4000-1:8000, sheep serum, home made), Anti-Actin Protein Antibody (1:30,000, mouse) (BD Transduction Laboratory ...
-
bioRxiv - Biophysics 2023Quote: ... Flow analysis of the correlation of protein production levels was carried out on a LSR II (BD Bioscience) equipped with 405 nm ...
-
bioRxiv - Immunology 2023Quote: Cytokines were analyzed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen or eBioscience were used for flow cytometry: Phycoerythrin (PE) or peridinin chlorophyll protein -cyanine 5.5 (PerCP-Cy5.5)-conjugated CD3 (BD Biosciences Cat#5 61808 ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies used included: C terminal binding protein-2 (mouse anti-CtBP2; BD Transduction Labs, used at 1:200), myosin-VIIA (rabbit anti-myosin-VIIA ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:200) and (2) C-terminal binding protein 2 (mouse anti-CtBP2; BD Biosciences; used at 1:200) with secondary antibodies coupled to Alexa Fluors 647 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... Cytokines were analysed using the Cytometric Bead Array (CBA) Mouse/Rat soluble protein flex set system (BD Bioscience), which was used according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Note these experiments were carried out using early access kits from BD Genomics before the implementation of commercially-available single-cell protein/RNA assays (e.g. Feature Barcoding, 10x Genomics; BD Abseq ...
-
bioRxiv - Immunology 2024Quote: ... and BD GolgiPlug Protein Transport Inhibitor (containing brefeldin A; 1 mg/mL; BD Biosciences, Franklin Lakes, NJ, USA). Following this ...
-
bioRxiv - Biophysics 2024Quote: ... transferred in a V-bottom 96-well plates and co-cultured with K562 cells (ATCC) at 1:1 effector-to-target ratio in the presence of mouse anti-human CD107a Alexa Fluor 647 (BD Bioscience, clone H4A3, 2 uL/well) for 6 hours at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were transferred to supported nitrocellulose membrane and probed using Syn101 antibodies against aSyn (BD labs, San Jose, CA). Blots were imaged on using a ChemiDoc MP imager and analyzed using Image Lab (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Genetics 2024Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Immunology 2020Quote: Multiscreen ninety-six well plates were coated overnight with 100 μl per well of 5 μg/ml anti-human interferon-γ (IFN-γ) (B27; Becton, Dickinson and Company, Franklin Lakes, NJ) in endotoxin-free Dulbecco’s-PBS (D-PBS) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...