Labshake search
Citations for Becton, Dickinson and Company :
2251 - 2300 of 4386 citations for Nuclear pore complex protein Nup93 dye Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Antibody staining was determined using a BD Fortessa instrument (BD, Franklin Lakes, NJ) and analyzed with FlowJo (BD ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-SMN mouse monoclonal antibody (BD Transd Lab, clone 8, #610646; 1:10,000), anti-GAPDH mouse monoclonal antibody (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... membranes were incubated with primary antibodies against monomeric α-synuclein (BD Bioscience, #610787), multimeric α-synuclein (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... and subjected to immunopanning with the rat-anti-mouse CD45 antibody (BD, 553076) and the secondary goat-anti-rat antibody (Jackson ImmunoResearch ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following primary antibodies were used: P-cadherin (BD Bioscience, #610227; 1:1,000), ERK1/2 (CST ...
-
bioRxiv - Immunology 2024Quote: ... Antibody cocktail panel 2 included: anti-CD45 (BV605, clone 30-F11, BD 563053), anti-CD3 (BV480 ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated with Fc receptor-blocking anti-CD16/CD32 antibody (BD Pharmingen) in FACS buffer for 15 minutes at 4⁰C ...
-
bioRxiv - Genomics 2024Quote: ... adaptor-ligated DNA fragments were immunoprecipitated with an anti-BrdU antibody (BD, #555627) and anti-mouse secondary antibody (Sigma-Aldrich #M7023 ...
-
bioRxiv - Genomics 2024Quote: ... cells were also labeled with an CD158b AbSeq antibody (BD, Cat. No. 559784). 98 μl of stain buffer ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stained with conjugated monoclonal antibodies directed at IFNγ (XMG1.2) from BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... The membranes were probed with antibodies directed to CXCR4 (1:1,000; BD Pharmingen) and GAPDH (1:10,000 ...
-
bioRxiv - Immunology 2024Quote: Cells were stained with the following antibodies for analysis: CD45 (565967, BD Biosciences), CD31 (102434 ...
-
bioRxiv - Cancer Biology 2024Quote: ... FITC Mouse Anti-Human MRP1 antibody (BD Biosciences, clone QCRL-3, cat#557593). Then cells were washed with PBS and analyzed by flow cytometry ...
-
bioRxiv - Cancer Biology 2024Quote: The following primary antibodies were used in these studies: BrdU (BD Pharmingen, B44), LC3B (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... USA). The primary antibody against TIM44 (Cat. No. 612582) was purchased from BD Transduction Laboratories (California ...
-
bioRxiv - Developmental Biology 2024Quote: ... The following fluorophore-conjugated antibodies were used: SOX2-V450 (BD 561610, 1:100), TUBB3-AF488 (BioLegend 801203 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100,000 EB dissociated cells were stained with the following antibodies (all BD Biosciences): CD34-PeCy7 (#560710) ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse monoclonal anti-Lamin A/C antibody (1:100) (BD Transduction Laboratories, 612162), goat polyclonal anti-Sox2 (R&D ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Immunology 2021Quote: ... FNA samples were stained in P2 for 30 minutes on ice with biotinylated and Alexa Fluor 647 conjugated recombinant soluble Spike proteins as well as PD-1 BB515 (EH12.1, BD Horizon). Cells were then washed twice with P2 and stained with IgG BV480 (goat polyclonal ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... To generate fluorescently tagged Env probes 2 μg of biotinylated Env protein was incubated with either 0.5 μg streptavidin-conjugated PE (BD Biosciences) or 0.5 μg streptavidin-conjugated BV786 (BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were stained with the following monoclonal antibodies: PE/ Cy7 anti-CD45 (552848, BD), APC anti-CD31 (561814 ...
-
bioRxiv - Cell Biology 2021Quote: ... IdU replication tracts were revealed with a mouse anti-BrdU/IdU antibody from BD Biosciences (347580 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and fluorochrome-labelled T-cell-specific antibodies targeting CD5 (clone 53-7.3, BD Biosciences) and CD44 (clone IM7 ...
-
bioRxiv - Cell Biology 2020Quote: ... Panleucocytes were identified using rat anti-mouse CD45 antibodies (BD Pharmingen Inc, Cat# 550539). CD11b+ microglia and macrophages were identified using rat anti-CD11b antibodies (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies used in this study were mouse anti-Nestin (BD Pharmingen 556309, 1/500) and rat anti-Vimentin (R&D systems MAB2105 ...
-
bioRxiv - Immunology 2021Quote: ... and an antibody cocktail containing anti-human CD3-Alexa Fluor 700 (UCHT1, BD Bioscience), CD4-APCeFluor 780 (RPA-T4 ...
-
bioRxiv - Microbiology 2021Quote: ... Slides were incubated with an anti-IL-8 antibody (Cat. # 550419, BD Pharmingen™) in 5% NGS with PBS at 4°C for overnight ...
-
bioRxiv - Immunology 2020Quote: ... Directly conjugated antibodies included α-CD3ε-PE-Cy7 (BB23-8E6-8C8, mouse IgG2a; BD), α-CD4-PerCP-Cy5.5 (74-12-4 ...
-
bioRxiv - Developmental Biology 2020Quote: The following antibodies and dilutions were used: anti-mouse Pdgfra-BV421 (BD, 1:100); anti-mouse Kdr-PE-Cy7 (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... and PerCP-Cy5.5-conjugated CD271 antibody (1:50 dilution; BD Biosciences cat. no. 560834), including single antibody-stained and unstained controls ...
-
bioRxiv - Molecular Biology 2021Quote: ... IdU incorporation was detected using a mouse anti-IdU antibody (BD; B44, 1:25) and BrdU incorporation was detected using a rat anti-BrdU antibody (Abcam ...