Labshake search
Citations for Becton, Dickinson and Company :
2101 - 2150 of 4284 citations for Nuclear pore complex protein Nup93 dye Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... or matched isotype antibodies (Rat IgG2a, κ PE-conjugated, lot 8096525, BD Biosciences) for 1h at RT while protected from light ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with the conjugated primary antibodies anti-CD45 (BD cat # 559864) and anti-Ter119 (Biolegend cat# 116211) ...
-
bioRxiv - Immunology 2023Quote: ... All intracellular antibodies were diluted 1:200 in Perm/Wash Buffer (BD Biosciences). Cells were acquired on an LSRFortessa flow cytometer and data were analyzed with FlowJo v10 ...
-
bioRxiv - Immunology 2023Quote: ... The following antibodies and stains were used: CCR2- BV421 (clone 475301, BD, 747963), Ly6C-BV510 (clone HK1.4 ...
-
bioRxiv - Physiology 2024Quote: ... as well as the monoclonal antibodies RORγT BV421 (clone Q3-378; BD Biosciences), Foxp3 AF647 (clone MF23 BD Biosciences) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following primary antibodies were used: α-CD31 (1:50, 550274, BD Biosciences), α-RFP (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... αCD8 antibody (both 1:3200 final concentration) and 10,000 sphero rainbow beads (BD) were added to wells prior to analysis of beads number ...
-
bioRxiv - Microbiology 2024Quote: ... Antibodies used for intracellular staining were as follows: CD3-BV480 (UCHT1 clone, BD), CD4-PerCP (L200 clone ...
-
bioRxiv - Immunology 2024Quote: ... The antibodies used for staining included: BB515 anti-Fas (clone DX2, BD Biosciences), BV786 anti-CD3 (clone SK7 ...
-
bioRxiv - Cell Biology 2024Quote: ... Antibodies against PECAM-1 (clone MEC 13.3) and mDia were obtained from BD Bioscience (Franklin Lakes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Antibody staining was determined using a BD Fortessa instrument (BD, Franklin Lakes, NJ) and analyzed with FlowJo (BD ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell suspension was stained with FITC-conjugated human CD90 antibody (BD Biosciences #555595) prior to Annexin-V APC binding assay (BD Biosciences #550474 ...
-
bioRxiv - Microbiology 2024Quote: ... and then neutrophils were incubated with PE-labeled antibodies against CD11b (BD Pharmingen), CD35 (Miltenyi Biotech) ...
-
bioRxiv - Neuroscience 2024Quote: ... and subjected to immunopanning with the rat-anti-mouse CD45 antibody (BD, 553076) and the secondary goat-anti-rat antibody (Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2024Quote: ... Antibody cocktail panel 1 included: anti-CD45 (BV605, clone 30-F11, BD 563053), anti-CD11b (APC-Cy7 Clone M1/70 BD 561039) ...
-
bioRxiv - Immunology 2024Quote: ... The following antibodies were used: anti-mouse CD31 (clone MEC 13.3; BD Biosciences), anti-mouse CD45 (clone 30-F11 ...
-
bioRxiv - Immunology 2024Quote: ... 100 μg of anti-IL-4Ra monoclonal antibody (clone mIL4R-M1, BD Biosciences), or IgG isotype control were intraperitoneal injected at different time points.
-
bioRxiv - Immunology 2024Quote: Cells were stained with the following antibodies for analysis: CD45 (565967, BD Biosciences), CD31 (102434 ...
-
bioRxiv - Genomics 2024Quote: ... adaptor-ligated DNA fragments were immunoprecipitated with an anti-BrdU antibody (BD, #555627) and anti-mouse secondary antibody (Sigma-Aldrich #M7023 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The following primary antibodies were used: P-cadherin (BD Bioscience, #610227; 1:1,000), ERK1/2 (CST ...
-
bioRxiv - Immunology 2024Quote: ... Antibody cocktail panel 2 included: anti-CD45 (BV605, clone 30-F11, BD 563053), anti-CD3 (BV480 ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated with Fc receptor-blocking anti-CD16/CD32 antibody (BD Pharmingen) in FACS buffer for 15 minutes at 4⁰C ...
-
bioRxiv - Immunology 2024Quote: ... blocked and incubated with the primary antibody of interest (anti-pSTAT5 AF647, BD Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated with the following primary antibodies: anti-Ly6G (BD Bioscience, #551459), anti-Vascular cell adhesion molecule 1 (VCAM1 ...
-
bioRxiv - Immunology 2024Quote: ... The following antibodies were used: anti-mouse CD31 (clone MEC 13.3; BD Biosciences), anti-mouse CD45 (clone 30-F11 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell-surface staining was performed using the following antibodies: CD45-Pacific Blue (BD), CD3-BV510 (BD) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then incubated with anti-Ki67 PE antibody (51-36525X, BD Bioscience) or with isotype PE (51-35405X ...
-
bioRxiv - Neuroscience 2024Quote: ... membranes were incubated with primary antibodies against monomeric α-synuclein (BD Bioscience, #610787), multimeric α-synuclein (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-SMN mouse monoclonal antibody (BD Transd Lab, clone 8, #610646; 1:10,000), anti-GAPDH mouse monoclonal antibody (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were incubated in freshly made SMN-antibody solution (mouse-anti-SMN, BD Bioscience 610647 ...
-
bioRxiv - Genomics 2024Quote: ... cells were also labeled with an CD158b AbSeq antibody (BD, Cat. No. 559784). 98 μl of stain buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... The membranes were probed with antibodies directed to CXCR4 (1:1,000; BD Pharmingen) and GAPDH (1:10,000 ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stained with conjugated monoclonal antibodies directed at IFNγ (XMG1.2) from BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... FITC Mouse Anti-Human MRP1 antibody (BD Biosciences, clone QCRL-3, cat#557593). Then cells were washed with PBS and analyzed by flow cytometry ...
-
bioRxiv - Biochemistry 2024Quote: ... USA). The primary antibody against TIM44 (Cat. No. 612582) was purchased from BD Transduction Laboratories (California ...
-
bioRxiv - Cancer Biology 2024Quote: The following primary antibodies were used in these studies: BrdU (BD Pharmingen, B44), LC3B (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... The following fluorophore-conjugated antibodies were used: SOX2-V450 (BD 561610, 1:100), TUBB3-AF488 (BioLegend 801203 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse monoclonal anti-Lamin A/C antibody (1:100) (BD Transduction Laboratories, 612162), goat polyclonal anti-Sox2 (R&D ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100,000 EB dissociated cells were stained with the following antibodies (all BD Biosciences): CD34-PeCy7 (#560710) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...