Labshake search
Citations for Becton, Dickinson and Company :
2101 - 2150 of 8819 citations for Myeloperoxidase MPO Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Seven days after electroporation a total of 5 × 106 T cells were collected and stained in 100 uL with fluorophore-conjugated anti-human antibodies for CD3 (BD Biosciences #564001), beta-2-microglobulin (BioLegend #316306 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human whole blood was collected from adult healthy volunteers with prior consent in heparinized vacutainer blood collection tubes (BD, Franklin Lakes, NJ) in accordance with Ahir et al. ...
-
bioRxiv - Cancer Biology 2019Quote: 5×105 human CD14+ cells were isolated from peripheral blood mononuclear cells (PBMC) using anti-CD14 beads (BD Biosciences, San Jose, CA) with a typical yield of ≥ 70% recovery and ≥ 90% purity ...
-
bioRxiv - Immunology 2019Quote: ... Immune cells were purified by FACS isolation of CD45 positive cells using APC Mouse Anti-Human CD45 (BD Pharmingen, clone: HI30 (RUO), American ...
-
bioRxiv - Biochemistry 2020Quote: ... and CD81 antibodies (with no beads) were added to the solution containing the EVs (PE Mouse Anti-Human CD81 Clone JS-81, BD Pharmingen™). After 1 h of incubation ...
-
bioRxiv - Immunology 2021Quote: ... Macaque cells were incubated with 100 μl of FACS buffer (PBS 1x with 2% fetal bovine serum and 1mM EDTA) with human Fc Block (BD Biosciences #564219) at a 1:500 dilution for 30 min on ice.
-
bioRxiv - Immunology 2021Quote: ... and viability dye (eBioscience™ Fixable Viability Dye eFluor™ 780) followed by Foxp3 staining with anti-FoxP3 (259D/C7) using Human FoxP3 buffer set (BD biosciences) according to the Manufacturer’s recommendations.
-
bioRxiv - Immunology 2021Quote: ... spleen and bone marrow were isolated and evaluated for the percentage of human CD45+ cells by flow cytometry (CD45-PerCP-Cy5.5, Biolegend Cat: 304028; BD FACS Canto II). Populations were defined and analyzed using FlowJo software (Flowjo v10.7.1 ...
-
bioRxiv - Immunology 2020Quote: ... a panel of four fluorescent markers was employed including fluorescein isothiocyanate (FITC) mouse anti-human CD40 (BD Biosciences; San Jose, CA, USA), phycoerythrin (PE ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated in media containing 10 µg/mL blocking antibody (Purified Rat Anti-Human CD29 Clone Mab 13, BD Biosciences, #552828) or equivalent concentration non-targeting isotype control (Purified Rat IgG2a κ Isotype Control Clone R35-95 ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were pre-coated with 10 ng/mL anti-CD3 mAb at 4°C overnight (Purified NA/LE mouse anti-human CD3, BD Cat# 557052). Three-fold serial dilutions of either IL-7 or a test compound were added to the cells and incubated for 4 days at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... A target primer panel was constructed by combining a commercial predesigned Human T Cell Expression Primer Panel (BD Biosciences, 259 target primers) with our custom-designed primer panel (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: The purity of each NK population was checked before and after cell sorting and routinely by flow cytometry with anti-human CD16-BV421 (clone 3G8, BD Pharmagen, France), anti-human CD56-PeCy7 (clone B159 ...
-
bioRxiv - Immunology 2023Quote: ... Cytometric Bead Array using enhanced sensitivity flex sets of human IL-2/IFN- γ/TNF- α was done following manufacturer’s instruction (BD Biosciences). Alternatively ...
-
bioRxiv - Molecular Biology 2021Quote: ... CA or 1: 1000 anti-OPA-1: 612607 and 1: 1000 anti-Drp-1: 611113 obtained from BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:4000 Sca-1-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:4000 Sca-1-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-LAMP-1 (1:2500; BD Biosciences), anti-Rab-7 (1:2500 ...
-
bioRxiv - Cell Biology 2019Quote: ... EEA1 (BD Biosciences, 1:100-1:200) and MPR (1:100-1:200) ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-caveolin-1 (BD Transduction, 1:500), and anti-paxillin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-PECAM-1 (1:400, BD), rabbit anti-laminin (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Flotilin-1 (1:1,000; #610820; BD Biosciences), or GM130 (1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-BP-1 (BP-1, BD Bioscience), anti-CD2 (RM2-5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-Flot-1 (1:1000, 610820, BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fibronectin 1 (1:1000; #610077; BD Biosciences), FAK (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: (1) Ly6G (1:300, 551459; BD Pharmingen)–Opal 540 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD31/PECAM-1 (1:300, BD), anti-ZO-1 (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... flotillin 1 (BD Transduction 610821, 1/1000), CD81 (Cell Signaling D3N2D ...
-
bioRxiv - Cell Biology 2023Quote: ... flotillin-1 (BD Biosciences, 610820, 1:1000), HSC70 (GeneTex ...
-
bioRxiv - Cancer Biology 2023Quote: (1) Ly6G (1:300, 551459; BD Pharmingen)–Opal 540 ...
-
bioRxiv - Immunology 2023Quote: ... PAC-1-FITC (1:10; BD Biosciences), and anti-CD62P-APC (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Microbiology 2019Quote: ... strains were streaked onto Trypticase Soy Agar II plates (TSA) containing 5% sheep blood (BD BBL, New Jersey, USA). For growth in liquid culture ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... MLO-Y4 cells were cultured as described on plastic tissue culture plates coated with rat-tail collagen I (BD). These cells are cultured in 2.5% heat-inactivated Fetal Bovine Serum (Characterized ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Cell Biology 2019Quote: ... Established iSML iPSCs were maintained in Nutristem-XF (Biological Industries) in plates coated with hESC-qualified matrigel (BD Biosciences) and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2019Quote: ... Rat hippocampal cells were plated on poly-D lysine coated 96 well imaging plates (BD Biosciences, San Jose, CA) (~16 plates per week ...
-
bioRxiv - Microbiology 2021Quote: ... Single colony was stab-inoculated with a sterile toothpick on the surface of LBNS plates (0.3% BD Bacto Agar). Plates were incubated upright at 37 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on PDL-coated 96-well microplates (7000 cells per well; black/clear imaging plate, BD Falcon 353219). RGCs were cultured in serum-free medium (Neurobasal/Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The diluted whole lung or cell lysate were then separately plated on Middlebrook 7H10 agar plates (BD Bioscience, #295964) along with streptomycin (50μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37 °C in anaerobic chambers with GasPak™ EZ Gas Generating Container System (BD Diagnostics) to maintain the anaerobic condition during the incubation for indicated time points ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 batches of 24 eggs each were placed in wells of 6-well plates (Falcon, BD Biosciences, Allschwil, Switzerland). Ten mL of diluted milt of 2 males each was prepared such that each male was represented with the same concentration of active sperm (25 Mio/mL ...