Labshake search
Citations for Becton, Dickinson and Company :
1951 - 2000 of 4096 citations for Major Intrinsic Protein Of Lens Fiber MIP Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Immunology 2021Quote: ... FNA samples were stained in P2 for 30 minutes on ice with biotinylated and Alexa Fluor 647 conjugated recombinant soluble Spike proteins as well as PD-1 BB515 (EH12.1, BD Horizon). Cells were then washed twice with P2 and stained with IgG BV480 (goat polyclonal ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were stained with the following monoclonal antibodies: PE/ Cy7 anti-CD45 (552848, BD), APC anti-CD31 (561814 ...
-
bioRxiv - Cell Biology 2021Quote: ... IdU replication tracts were revealed with a mouse anti-BrdU/IdU antibody from BD Biosciences (347580 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and fluorochrome-labelled T-cell-specific antibodies targeting CD5 (clone 53-7.3, BD Biosciences) and CD44 (clone IM7 ...
-
bioRxiv - Cell Biology 2020Quote: ... Panleucocytes were identified using rat anti-mouse CD45 antibodies (BD Pharmingen Inc, Cat# 550539). CD11b+ microglia and macrophages were identified using rat anti-CD11b antibodies (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies used in this study were mouse anti-Nestin (BD Pharmingen 556309, 1/500) and rat anti-Vimentin (R&D systems MAB2105 ...
-
bioRxiv - Cell Biology 2019Quote: ... EdU-stained larvae were also incubated with rabbit anti-active Caspase3 antibody (BD Biosciences) at 1:200 in block (PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary antibodies were against HIF-1α (clone 54, 1:1000; BD Biosciences, Oxford, UK), HIF-2α (ep190b ...
-
bioRxiv - Immunology 2021Quote: ... and an antibody cocktail containing anti-human CD3-Alexa Fluor 700 (UCHT1, BD Bioscience), CD4-APCeFluor 780 (RPA-T4 ...
-
bioRxiv - Microbiology 2021Quote: ... Slides were incubated with an anti-IL-8 antibody (Cat. # 550419, BD Pharmingen™) in 5% NGS with PBS at 4°C for overnight ...
-
bioRxiv - Immunology 2020Quote: ... Directly conjugated antibodies included α-CD3ε-PE-Cy7 (BB23-8E6-8C8, mouse IgG2a; BD), α-CD4-PerCP-Cy5.5 (74-12-4 ...
-
bioRxiv - Developmental Biology 2020Quote: The following antibodies and dilutions were used: anti-mouse Pdgfra-BV421 (BD, 1:100); anti-mouse Kdr-PE-Cy7 (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... and PerCP-Cy5.5-conjugated CD271 antibody (1:50 dilution; BD Biosciences cat. no. 560834), including single antibody-stained and unstained controls ...
-
bioRxiv - Molecular Biology 2021Quote: ... IdU incorporation was detected using a mouse anti-IdU antibody (BD; B44, 1:25) and BrdU incorporation was detected using a rat anti-BrdU antibody (Abcam ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20 μL of each antibody (FITC Mouse Anti-Human CD31 (BD Pharmingen™, 555445) and PE Mouse Anti-Human CD140b (BD Pharmingen™ ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... Alexa Fluor 647-conjugated PECAM-1 monoclonal mouse antibody was bought from BD (561654) (whole-mount stain 1:200) ...
-
bioRxiv - Immunology 2022Quote: ... The following antibodies were used: anti-mouse CD8 PerCP (BD Biosciences, San Jose, CA), anti-mouse CD11b FITC (BD Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: Antibody dilutions: mouse anti-p62 (1:100, BD Bioscience – 1:200 for STED microscopy); rabbit anti-p62 (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... anti-IgD-BV510 antibodies then sorted at 4°C with FACS Aria (BD Bioscience). Post-sort purity was checked ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then incubated with an Alexa Fluor 488 anti-BrdU antibody (558599, BD Biosciences) for 15 minutes and finally resuspended in RNase/PI buffer (550825 ...
-
Caspase-8 Modulates Angiogenesis By Regulating A Cell Death Independent Pathway In Endothelial CellsbioRxiv - Developmental Biology 2019Quote: ... Samples were incubated with primary antibody (anti-VE-cadherin, 1:200, 610252, BD Bioscience) for 2h at RT followed by incubation with the appropriate Alexa Fluor™-conjugated secondary antibody for 2h at RT ...
-
bioRxiv - Pathology 2019Quote: ... CD127 (HIL-7R-M21) and HLA-DR (G46-6) antibodies were purchased from BD Biosciences ...
-
bioRxiv - Bioengineering 2019Quote: ... purified monoclonal rat anti-mouse antibodies for MAdCAM-1 (clone MECA-367; BD-Biosciences) or control isotype (clone R35-95 ...
-
bioRxiv - Immunology 2020Quote: ... following manufacturer’s instructions and stained with antibodies specific for IFNγ (clone XMG1.2, BD Biosciences) and TNFα (clone MP6-XT22 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and rabbit antibody directed against Hsp90 (Cat#610418 BD Transduction Lab, 1:1000 dilution) were diluted in blocking buffer supplemented with 0.1% Tween-20 (TBS-T) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and directly stained with PE-labeled anti-human CD274 antibody (Clone MIH1, BD Biosciences) before washing with PBS and fixation with 2% formaldehyde ...
-
bioRxiv - Neuroscience 2019Quote: Primary antibodies: α-syn monoclonal mouse-anti-α-syn (BD Biosciences, catalog no. 610787), polyclonal rabbit-anti-α-syn (ASY1 [30]) ...
-
bioRxiv - Immunology 2021Quote: ... then stained with cocktail of primary antibodies including: anti-mouse CD45-BUV395 (BD Horizon), anti-mouse EPCAM-PECy7 (BioLegend) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse monoclonal antibody for EGFR (610016; 1:1,000 for immunoblotting) was purchased from BD Biosciences (San Jose ...