Labshake search
Citations for Becton, Dickinson and Company :
1801 - 1850 of 3871 citations for E3 Ubiquitin Protein Ligase RNF128 RNF128 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The following antibodies were used: HLA-DP-BV421 (B7/21, BD Biosciences, 750875), HLA-DP-APC (B7/21 ...
-
bioRxiv - Immunology 2023Quote: ... The following monoclonal antibodies were used: CD3 APC-Cy7 (clone SP34.2, BD Biosciences), CD4 PE-Cy5.5 (clone SK3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and anti-CD14 antibodies (3 µL CD14 PE-CF594, clone: MφP9, BD Biosciences) was also performed to improve capture of less abundant cell populations from the CD45- fraction ...
-
bioRxiv - Cell Biology 2023Quote: ... Monoclonal anti-FAK (#610088) and monoclonal anti-paxillin (#610052) antibodies were from BD Bioscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following antibodies were used for flow cytometry: CD8α-BUV395 (BD Biosciences, 563786), CD4-BV605 (BioLegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... Incorporated halogenated nucleotides were detected with a mouse anti-IdU monoclonal antibody (BD) and a rat anti-CldU monoclonal antibody (Accurate ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies consisted of anti-δ-catenin (BD Biosciences, 1:1000, 611537), anti-GluA1 (RH95 ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified Mouse anti-E-Cadherin monoclonal antibody (Clone 36) (610181, BD Transduction Laboratories); WAVE2 antibody (H-110 ...
-
bioRxiv - Microbiology 2023Quote: ... and processed for western blot analysis using mouse anti-FAK antibody (BD Biosciences) or phosphosite-specific mouse anti-pFAK(Y397 ...
-
bioRxiv - Immunology 2023Quote: ... and supplemented with soluble anti-CD28 antibodies (2ug/mL clone: 37.51, BD Biosciences). Cells were cultured for 48 hrs before analysis.
-
bioRxiv - Molecular Biology 2024Quote: ... The primary antibodies used in this study were: anti-aSyn (610787, BD Biosciences), anti-Sph1 (sc-365741 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies were: mouse monoclonal anti-ýII spectrin (1:500; BD Transduction, #612562), to label hair bundles and show the location of the kinocilium by absence of label ...
-
bioRxiv - Pathology 2024Quote: A rat anti-mouse LY6G antibody labeled with PE (clone 1A8, BD Biosciences), a rat anti-mouse GPIb-beta Dylight 649 (clone X649 ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were ex vivo-stimulated with anti-CD107a antibody (BD Biosciences, 553792), anti-CD28/CD49d antibody (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... biotinylated anti-mouse IgG1 or IgM detecting antibody (0.5 mg/ml; BD Biosciences) plus streptavidin-HRP reagent (1:250 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse monoclonal antibodies against GM130 (#610822) and GS15 (#610960) were purchased from BD Bioscience ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2.5 mM CaCl2) containing 1 µL Annexin V-BV421 antibody (BD Biosciences, 563973). Fluorescent intensity of 10 000 cells was detected by flow cytometry on a FACS instrument (MACSQuant®VYB ...
-
Nucleocytoplasmic transport rates are regulated by cellular processes that modulate GTP availabilitybioRxiv - Cell Biology 2023Quote: ... Cells were incubated with primary antibodies for 30 min: Mouse anti-Ran (BD Transduction Laboratories ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mix of antibodies was incubated with Brilliant Stain Buffer Plus (BD Biosciences) and cells were preincubated in Human TruStain FcX™(Biolegend ...
-
bioRxiv - Immunology 2024Quote: ... Intracellular antibodies were: APC anti-mouse IFN-γ (BD Biosciences, #554413, 1:100), PE anti-mouse IL-17A (eBiosciences ...
-
bioRxiv - Cancer Biology 2024Quote: Fluorescent-conjugated flow cytometry antibodies for mouse tumor experiments were obtained from BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-E-Cadherin monoclonal antibody [5 mg/ml] (610181, BD Transduction Laboratories), rabbit anti-FOXA1 monoclonal antibody [5 mg/ml] (ab173287 ...
-
bioRxiv - Cell Biology 2024Quote: ... Remaining cells were resuspended and blocked by FcBlock antibody (5 mg/ml, BD) for 10 min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were stained with FITC conjugated anti Human MUC1 antibody (BD, Cat # 559774) for 30 minutes at 4 °C in dark condition at recommended dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Immunology 2021Quote: ... FNA samples were stained in P2 for 30 minutes on ice with biotinylated and Alexa Fluor 647 conjugated recombinant soluble Spike proteins as well as PD-1 BB515 (EH12.1, BD Horizon). Cells were then washed twice with P2 and stained with IgG BV480 (goat polyclonal ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were stained with the following monoclonal antibodies: PE/ Cy7 anti-CD45 (552848, BD), APC anti-CD31 (561814 ...
-
bioRxiv - Cell Biology 2021Quote: ... IdU replication tracts were revealed with a mouse anti-BrdU/IdU antibody from BD Biosciences (347580 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and fluorochrome-labelled T-cell-specific antibodies targeting CD5 (clone 53-7.3, BD Biosciences) and CD44 (clone IM7 ...