Labshake search
Citations for Becton, Dickinson and Company :
1801 - 1850 of 8443 citations for 6H Imidazo 4 5 e 2 1 3 benzothiadiazole 7 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: CD3-AF700 (clone: SP34-2; BD Biosciences), CD4-BV711 (clone ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% (w/v) Bacto peptone (BD Biosciences), and 2% (w/v ...
-
bioRxiv - Immunology 2021Quote: ... CD3 APC-Cy7 (clone SP34-2, BD Biosciences Cat# 557757 ...
-
bioRxiv - Immunology 2021Quote: ... CD3 Cy7APC (clone SP34-2, BD Pharmingen). Biotinylated prefusion-stabilized spike (S-2P ...
-
bioRxiv - Immunology 2020Quote: ... from Biolegend and CD138-APC (281-2) from BD Biosciences.
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μg/ml Laminin (BD Bioscience) in DMEM/F12 medium supplemented with 1X B27 ...
-
bioRxiv - Immunology 2021Quote: ... and 2 μg/ml anti-CD28 (BD) in the presence of 20 ng/ml IL-6 (PeproTech) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v galactose (BD Biosciences 216310)) at an OD600 of 0.3 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), and 2% w/v raffinose (Becton Dickinson 217410)) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), 2% w/v galactose (BD Biosciences 216310) ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV421 (BD, 563259), 1 μl of SA-BUV615 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV480 (BD, 564876), 2 μl of SA-BV421 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV605 (BD, 563260), 2 μl of SA-BV480 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BUV395 (BD, 564176), 0.4 μl of SA-BYG670 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV650 (BD, 563855), 2 μl of SA-BV605 (BD ...
-
bioRxiv - Immunology 2021Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (Clone GK1.5 ...
-
bioRxiv - Genomics 2021Quote: ... Panel 2: CD206 (19.2, PE, 555954 BD), CD36 (SMΦ ...
-
bioRxiv - Immunology 2021Quote: ... Surface markers include: CD3 (SP34-2, BD), CD4 (L200 ...
-
bioRxiv - Immunology 2021Quote: ... CD3e (clone SP34-2, BD Biosciences, 557917), CD4 (clone L200 ...
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD3-APC (SP34-2, BD Pharmingen) and anti-IFN-γ-PE (4S.B3 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Systems Biology 2022Quote: ... coli strain JM109 (1 × 1010 colony-forming units (CFU)/ml) were cultured for various times in 2 ml of 2xYT liquid medium (BD Difco, Cat# 244020) containing various concentrations of pyridoxal 5’ -phosphate (pH adjusted to 7.0) ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... Cells were incubated in the dark with 2 μl/1×106 cells of CD16/32 antibody (Fc block; BD Biosciences, Mississauga, ON, Canada) for 15 minutes at RT ...
-
bioRxiv - Immunology 2022Quote: ... blood cells were stained in 50 µl 2% FCS RPMI medium with antibodies against CD11C (APC, clone HC3, BD biosciences, dilution 1/100), CD11b (PercPCy5.5 or Pacific Blue ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody shifts were done by incubating the protein/extract with 4uL of antibody (α-Twist: Invitrogen PA5-47824, α-Snail: Santa Cruz E-18, α-Sox9: Abcam ab3667, α-E47: BD Pharmingen 554077) for 15 minutes at 25°C before adding radiolabeled probe ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2023Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Bioengineering 2019Quote: ... containing 5% (vol/vol) Nu-Serum I (BD Biosciences), 1% ITS+ Premix (BD Biosciences) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and CD4-Alexa Fluor 700 (RM4-5) from BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...