Labshake search
Citations for Becton, Dickinson and Company :
1651 - 1700 of 7344 citations for Rat Fibrinogen Like Protein 1 FGL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... WBC were quantified using the Leucocount Kit (BD, 340523). Platelet unit pH was measured daily by adding 25 μL of the platelet unit to pH strips with a pH range of 5-9 (Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... labeled with Mouse Immune Single-Cell Multiplexing Kit (BD) and loaded on a microwell cartridge of the BD Rhapsody Express system (BD ...
-
bioRxiv - Immunology 2023Quote: ... using Cytofix/Cytoperm Fixation/Permeabilization Solution kit (BD Biosciences) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Viability was analyzed with Kit 7AAD/Annexin (BD Pharmingen), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences) according to manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The Cytokine Bead Array kit was procured from BD Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Synthetic Biology 2022Quote: ... all samples were mixed 1:1 with prewarmed CytoFix Fixation Buffer (BDBiosciences #554655) and incubated at room temperature for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... rabbit anti-MCM2 (Cell Signaling, 4007S; 1:1000; BD Biosciences, 610701; 1:1000), rabbit anti-MCM3 (Cell Signaling ...
-
bioRxiv - Developmental Biology 2019Quote: ... Figure 1 and figure 2: CD235a-PeCy7 (1:100, BD, GA-R2(HRI2)) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse monoclonal anti-Pdcd6ip (AIP-1/Alix) (BD transduction lab 611620, 1:500); goat polyclonal anti-TSG101 (Santa Cruz sc-6037 ...
-
bioRxiv - Microbiology 2020Quote: ... 250 µg mL−1 L-cycloserine and 1.5% weight vol−1 (BD, USA) (TCCFA plates) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-nestin (1:200 in vivo, 1:500 in vitro, BD Bioscience), chicken anti-vimentin (1:10,000 ...
-
bioRxiv - Cancer Biology 2022Quote: CD44 (1:200, IM7, #560568), CD11b (1:800, M1/70, #563553) (BD Biosciences); MHC-I (1:100 ...
-
bioRxiv - Physiology 2022Quote: ... Gr-1 (catalog no. 550291, 1/50, BD Pharmingen, Franklin Lakes, NJ, USA) and the cholangiocyte marker cytokeratin-19 CK19 (TROMA-III 1/500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Col IΔ R/R fibroblasts diluted 1:1 with BD Matrigel (BD Biosciences) in a total volume of 100 μl ...
-
bioRxiv - Cancer Biology 2019Quote: ... A 100 μl volume of 1:1 mixture of Matrigel (354248; BD Biosciences) and 1 × 106 MiaPaCa2 cells alone ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-Aurora kinase 1 (Cat no. 611082, 1:100 PLA, BD Biosciences), mouse anti-Actin (MAB1051 ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD101 (clone Moushi101, 1:100 eBioscience; clone 307707, 1:100 BD Biosciences). For MMP-9 and IL-1ß intracellular staining ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse monoclonal antibodies to Aurora B (AIM-1; BD Bioscience 611082, 1:100) and H3S10ph (6G3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or RIVA cells were mixed in a 1:1 in Matrigel (BD Biosciences)/PBS and injected into the flanks of 10-week-old NSG mice ...
-
bioRxiv - Bioengineering 2024Quote: ... and anti-E-cadherin-1 (ECAD; 1:500; 610181, BD Biosciences, CA, USA). Nuclear counterstaining was performed with DAPI (Nacalai Tesque ...
-
bioRxiv - Genomics 2023Quote: ... and incubated overnight with Purified Mouse Anti-TEF-1 (1:500, BD-610922) or mouse anti-YAP1 H-9 (1:150 ...
-
bioRxiv - Immunology 2019Quote: ... were injected subcutaneously along with engineered stromal cells (1:1 to 1:5 ratio HSPC/MS5) in 200 μl of ice-cold Matrigel® (BD Biosciences). Mice were sacrificed at day 12 of differentiation by cervical dislocation and Matrigel® plugs were collected ...
-
bioRxiv - Immunology 2021Quote: ... and re-suspended in 100 μL permeabilisation buffer (FACS buffer, 1% BSA, 1 mM EDTA in PBS containing 1 X BD permeabilisation reagent). FITC-conjugated anti-influenza NP monoclonal antibody (Abcam clone 20921 ...
-
bioRxiv - Neuroscience 2019Quote: ... Primary antibodies (Claudin-5, Abcam Ab131259, 1:1000; Collagen IV, Abcam Ab6586, 1:500; Hemoglobin, R&D Systems G-134-C, 1:300; P62, BD Biosciences 610833 ...
-
bioRxiv - Cell Biology 2022Quote: ... F4/80 (1:100 dilution, clone Cl:A3-1; Serotec, Cat# MCA497) and CD11b (1:100 dilution, clone M1/70; BD Biosciences, Cat# 550282).
-
bioRxiv - Immunology 2023Quote: ... FITC CD8 (Clone 53-6.7, 1:25), Alexa Fluor 700 CD44 (Clone IM7, 1:50), and PE CD62L (Clone MEL-14, 1:50) (BD Pharmingen, CA), and the yellow LIVE/DEAD® dye (1:300) ...
-
bioRxiv - Cancer Biology 2023Quote: ... SCC13 tumour cells and fibroblasts were mixed in a 1:1 ratio in complete DMEM containing 1% Matrigel (BD Biosciences, Cat# 354230). Cells were plated on 8-well glass bottom culture slides (Corning ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with the primary antibodies (1D4 1:1500, Anti-Calnexin Sigma c4731 1:600, Anti-LgBiT Promega N7100 1:100, Anti-GM130 BD Transduction 610823) for 1 hour and 30 minutes at room temperature in blocking/permeabilization solution ...
-
bioRxiv - Immunology 2024Quote: ... labelled K562 at a ratio of 1:1 for 1 hour and conjugate formation was evaluated by flow cytometry (Fortessa X20™, BD Biosciences).