Labshake search
Citations for Becton, Dickinson and Company :
1551 - 1600 of 1653 citations for Recombinant Human SUMF1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Immunology 2020Quote: Multiscreen ninety-six well plates were coated overnight with 100 μl per well of 5 μg/ml anti-human interferon-γ (IFN-γ) (B27; Becton, Dickinson and Company, Franklin Lakes, NJ) in endotoxin-free Dulbecco’s-PBS (D-PBS) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Plant Biology 2019Quote: ... The coding sequence of AGL16 was cloned into pAD-GAL4-2.1 (AD vector) and the putative protein binding sites were cloned into pHIS2 (BD vector). These constructs of pAD and pHIS2 plasmids were introduced into Y187 yeast strain by heat shock ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Bioengineering 2024Quote: ... for 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail: anti-human CD19 (Becton, Dickinson and Company, BD, Franklin Lakes, NJ, USA, cat.: 562440), anti-human CD20 (BioLegend ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was determined by BCA assay and 250 µg protein lysates were incubated with anti-Myc (2.5 µg, BD Pharmingen 551102) or anti-IgG (2.5 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... and macrophage chemoattractant protein-1 (MCP-1) were quantified by bead-based flow cytometry assay (CBA Kit; BD Biosciences, Heidelberg, Germany) in accordance with the instructions of the manufacturer.
-
bioRxiv - Molecular Biology 2021Quote: ... run on PAGE together with input sample (1:20 of amount of immunoprecipitated proteins) and blotted with anti-PARP1 (Mouse Mab 551025 BD Pharmigen), anti-TRF1 (Rabbit Pab sc-6165 ...
-
bioRxiv - Microbiology 2022Quote: ... was used as a secondary antibody. Surface expression level of S proteins (Extended Data Fig. 6a) was measured using FACS Canto II (BD Biosciences) and the data were analysed using FlowJo software v10.7.1 (BD Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... High sensitivity C-reactive protein (CRP) was measured in serum: blood was collected into a silica and gel containing tube (BD Vacutainer).
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated for 4 h with eBioscience™ Cell Stimulation Cocktail and a protein transport inhibitor-containing Brefeldin (1.5uL/mL StopGolgi; BD Biosciences). Cells were then washed in FACS buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... macrophage inflammatory protein (MIP-1α) and tumor necrosis factor (TNF-α) were detected using Cytometric Bead Array (CBA) technology (BD Biosciences) and assayed on an Accuri C6 flow cytometer (BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: Cytometric bead array (CBA) was performed using the mouse soluble protein master buffer kit combined with the appropriate CBA flex sets (BD Biosciences), per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1uM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilization step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins of interest were visualized after incubation with primary antibodies (α-synuclein 1:1000 BD Biosciences (San Jose, CA, USA) #610787 ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were extensively washed with PBS and stained with NeutrAvidin Protein DyLight 488 1:50 for 20 min prior analysis using an Accuri C6 Flow Cytometer (BD Biosciences) with side-scatter (height ...
-
bioRxiv - Cell Biology 2022Quote: ... Green fluorescent protein (GFP) positive cells in HRasL61 with GFP transfected cells were sorted using flow-cytometry (FACS Aria II; BD Bioscience).
-
bioRxiv - Physiology 2022Quote: The geometric mean fluorescence intensities (MFI) corresponding to the probes/target protein levels were determined by flow cytometry acquired on Aria II (BD Biosciences) or CytoFLEX (Beckman Coulter ...
-
bioRxiv - Immunology 2022Quote: PBS-washed cells were PFA-fixed and immunostained for individual surface protein expression using the following antibodies: Anti-CD3-FITC (#561807; BD Biosciences), anti-CD4-APC (#555349 ...
-
bioRxiv - Immunology 2022Quote: ... mR and mL were determined by comparing mean fluorescence intensity (MFI) of targeted proteins stained by saturating amount of fluorescently-tagged antibody to MFI of PE quantitation beads (BD Biosciences). Ac and tc are controlled parameters during experiments.
-
bioRxiv - Immunology 2022Quote: ... and 10% heat-inactivated FBS) and incubated at 37°C for 6 hours with protein transport inhibitors GolgiStop and GolgiPlug (BD Biosciences) and S glycoprotein peptide pools 1 μg/mL (JPT product PM WCPV-S-1 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Tissues were incubated at 4°C overnight with the following primary antibodies: monoclonal mouse anti-carboxyl-terminal binding protein 2 (CtBP2) IgG1 at 1:200 (612044; BD Biosciences) counterstained with goat anti-Mouse IgG1 conjugated with Alexa Fluor 568 (#A-21124) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 344SQ murine lung adenocarcinoma cells expressing firefly luciferase and green fluorescent protein (in 50 μL of 1:1 mix of HBSS and BD Matrigel) were injected into the left lung of 8 weeks old female 129/Sv mice via intrapulmonary injection as described previously (50) ...
-
bioRxiv - Immunology 2020Quote: PBMCs or purified T cells were stained for 30 minutes on ice with the antibodies specific for extracellular proteins in Brilliant Stain Buffer (BD, 563794). Following incubation ...