Labshake search
Citations for Becton, Dickinson and Company :
1501 - 1550 of 3684 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... cells were trypsinized and washed 2 x stain buffer (FBS) (BD Biosciences®) and stained using the BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Biosciences®) ...
-
bioRxiv - Immunology 2022Quote: ... quenched type 2 RNase H-specific substrate without addition of RNase HII (BD), quenched type 2 RNase H-specific substrate with addition of heat-inactivated cell lysate (BD + h.i ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells (2 × 106 cells/100 μl) were mixed with Matrigel (100 μl) (BD) on ice and hypodermically injected into NOD-SCID mice using a 22-gauge needle ...
-
bioRxiv - Immunology 2021Quote: ... and stained with an antibody cocktail of CD3 (clone SP34-2, BD Biosciences), CD4 (clone OKT4 ...
-
bioRxiv - Immunology 2021Quote: ... and cells were suspended in 2% FBS/DPBS buffer with Fc Block (BD) for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... Subsequently cells were stained with 2 μl of anti-CD8-BUV805 (BD, 564912), 1 μl of anti-CD4-APC-H7 (BD ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed and permeabilized in 2 × FACS BD Lysis Solution (BD Biosciences) with 0.08% Tween20 in ddH2O for 10 min at RT in the dark ...
-
bioRxiv - Immunology 2020Quote: ... NHP cells were stained with the following antibodies: CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7 ...
-
bioRxiv - Immunology 2019Quote: ... The following antibodies used were: anti-CD3–PE (clone SP34-2, BD Biosciences), anti-CD4–PerCP-Cy5.5 (clone L200 ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 2% BSA and stained with antibodies against CD19-PE (BD-555413), CD3-BV510 (BD-564713) ...
-
bioRxiv - Microbiology 2020Quote: ... tularensis was streaked onto Cystine Heart Agar supplemented with 2% Hemoglobin (CHAB) (BD) and incubated at 37°C for 72 hours ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with antibodies for IL-2 (BD Biosciences, 1:100, JES6-5H4) for 30 minutes at room temperature and analyzed in flow cytometry.
-
bioRxiv - Physiology 2024Quote: ... MEAs were coated with Matrigel (2% v/v) (BD Biosciences, San Diego, CA) as described [11b ...
-
bioRxiv - Immunology 2024Quote: ... soluble anti-CD28 (2 µg/ml, clone 37.51, BD Biosciences, San Diego, CA), recombinant IL-4 (20 ng/ml ...
-
bioRxiv - Genomics 2024Quote: ... 2 µM of 5.6-carboxyfluorescein diacetate succinimidyl ester or CFSE (BD Biosciences, USA) was added to the cells and incubated for 5 minutes at 370C ...
-
bioRxiv - Immunology 2023Quote: ... Surface Abs were used as follows: CD3-V450 (SP34-2, V450, BD Biosciences), CD4-APC (L200 ...
-
bioRxiv - Immunology 2022Quote: ... Table 1 and 2 BD Fortessa™ Flow Cytometer (BD Biosciences, Heidelberg, Germany) was used to perform flow cytometry ...
-
bioRxiv - Neuroscience 2023Quote: ... Blood was transferred to a sterile 2 ml serum blood collection tube (BD Vacutainer ...
-
bioRxiv - Microbiology 2023Quote: ... cells were incubated with 2 μg/mL IFNGR1-neutralizing antibody (BD Bioscience #557531) or an isotype control (BD Bioscience #554721 ...
-
bioRxiv - Immunology 2023Quote: ... The following antibodies were used: anti-mouse CD3 (clone 17A-2, BD Biosciences), CD11c (clone HL3 ...
-
bioRxiv - Immunology 2023Quote: ... The following antibodies were used: anti-mouse CD3 (clone 17A-2, BD Biosciences), CD45 (clone 30-F11 ...
-
bioRxiv - Immunology 2023Quote: ... TCR stimulation was measured by IL-2 ELISA on culture supernatant (BD 555148).
-
bioRxiv - Cell Biology 2024Quote: ... MEAs were coated with Matrigel (2% v/v) (BD Biosciences, San Diego, CA) prior to seeding of cells ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were then stained in FACS buffer with anti-pMEK1/2 (BD Biosciences) and anti-pERK1/2 (BD Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Microbiology 2019Quote: ... strains were streaked onto Trypticase Soy Agar II plates (TSA) containing 5% sheep blood (BD BBL, New Jersey, USA). For growth in liquid culture ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... MLO-Y4 cells were cultured as described on plastic tissue culture plates coated with rat-tail collagen I (BD). These cells are cultured in 2.5% heat-inactivated Fetal Bovine Serum (Characterized ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Cell Biology 2019Quote: ... Established iSML iPSCs were maintained in Nutristem-XF (Biological Industries) in plates coated with hESC-qualified matrigel (BD Biosciences) and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2019Quote: ... Rat hippocampal cells were plated on poly-D lysine coated 96 well imaging plates (BD Biosciences, San Jose, CA) (~16 plates per week ...
-
bioRxiv - Microbiology 2021Quote: ... Single colony was stab-inoculated with a sterile toothpick on the surface of LBNS plates (0.3% BD Bacto Agar). Plates were incubated upright at 37 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on PDL-coated 96-well microplates (7000 cells per well; black/clear imaging plate, BD Falcon 353219). RGCs were cultured in serum-free medium (Neurobasal/Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The diluted whole lung or cell lysate were then separately plated on Middlebrook 7H10 agar plates (BD Bioscience, #295964) along with streptomycin (50μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37 °C in anaerobic chambers with GasPak™ EZ Gas Generating Container System (BD Diagnostics) to maintain the anaerobic condition during the incubation for indicated time points ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 batches of 24 eggs each were placed in wells of 6-well plates (Falcon, BD Biosciences, Allschwil, Switzerland). Ten mL of diluted milt of 2 males each was prepared such that each male was represented with the same concentration of active sperm (25 Mio/mL ...
-
bioRxiv - Microbiology 2021Quote: ... 30 and 38 community composition was measured by plating on nutrient agar plates (5g/L peptone BD difco, BD Bioscience ...
-
bioRxiv - Immunology 2020Quote: ... CD19+ Pf+ or HA+ B cells were single cell–sorted into 96-well plates using a FACSAria II (BD). Index sorting was used to determine isotype and B cell subsets by IgM ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed with PBS prior to the addition of 100 μL/well TMB substrate (BD Biosciences). Fifteen minutes after the addition of substrate ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample (100 μL) was then cultured in plates of potato dextrose agar (1% Difco PDA; BD company, France) and carboxymethyl cellulose (1% CMC ...
-
bioRxiv - Microbiology 2022Quote: ... They were cultivated on PDA plates at 25°C for growth and in potato dextrose broth (BD Difco™) culture for genomic DNA extraction as previously reported41 ...
-
bioRxiv - Cancer Biology 2021Quote: ... isolated GSCs or GSCs expressing shHAUSP were cultured on plates or coverslips pretreated with the Matrigel (354230; BD Biosciences) and induced for differentiation in serum-containing medium (1% FBS in DME ...
-
bioRxiv - Cell Biology 2022Quote: ... The sorting into 384-well plates was performed with a 100 µm nozzle on BD FACS AriaIII CellSorter (BD BioScience Flow Cytometry System equipped with four lasers ...