Labshake search
Citations for Becton, Dickinson and Company :
1501 - 1550 of 7577 citations for 2 Bromo 1 5 bromofuran 2 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5 g yeast extract (Becton, Dickinson And Company), and 10 g NaCl per liter of water ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% skim milk (cat. #232100, BD) for 1 hour and incubated with appropriate antibody ...
-
bioRxiv - Immunology 2024Quote: ... biotinylated anti-mouse IL-5 (TRFK4, BD Biosciences); IL-13 ...
-
bioRxiv - Immunology 2024Quote: ... BV650 andi-CD64 (X54-5/7.1; BD Biosciences), BV711 anti-TNF (XP6-XT22 ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 g/L Bacto yeast extract (BD Biosciences), and 5 g/L NaCl ...
-
bioRxiv - Immunology 2022Quote: ... 1.5 µg/mL) [31] in the presence of anti-CD28 and anti-CD49d antibodies (both at 1 μg/ml, BD, Franklin Lakes, New Jersey) and brefeldin-A (10 μg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... filters were blocked in 5% BSA and probed overnight at 4°C with the following primary antibodies and dilutions: p16 (1:200, #554079 BD Biosciences, San Jose, CA), p53 (1:200 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... for 30 min (RT) and incubated overnight (4 °C) with mouse anti-5-LOX (1:1000; # 610695; Lot: 9067817; BD Biosciences, Franklin Lakes, NJ) and rabbit anti-perilipin-2 (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... The following surface antibodies were used at the manufacturer recommended dilution of 0.25 μg antibody per million cells with the exception of CD57 APC which was tittered down 1/5 in order to be on scale: HLA-DR BUV395 (BD Biosciences, Clone: G46-6), NKp46 BV650 (BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: The following primary antibodies (all diluted in 5% non-fat milk in TBST) were used at the final concentration indicated: mouse anti-B56a (BD Biosciences 610615, 1:2000), mouse anti-B56g (Santa Cruz Biotechnology sc-374379 ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated on ice for 5 min with rat anti-CD16/CD32 antibody (BD Biosciences, clone 2.4G2, 5 µg/ml) and Fixable Viability Dye eFluor 660 or UV455 (eBioscience ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell pellet was resuspended in 1 mL sterile PBS/5% FBS and transferred to a 5 mL flow cytometry tube via a 40 µm strainer cap (BD Falcon). Viability of the final samples was between 30-35% by trypan blue exclusion ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD2 PE (clone RM2-5, BD Pharmingen, RRID: AB_2073810), CD5 PE (clone 53-7.3 ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-CD4 (clone RM4-5, BD Bioscience, cat # BDB553043), anti-CD8 (clone 4SM15 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... After blocking with 5% nonfat milk (BD Biosciences, USA) for 2h ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ (BV785 or BV605, GK1.5 or RM4-5, BD) Thy1.1+ ...
-
bioRxiv - Immunology 2024Quote: ... monensin (5 mg/ml; Golgi Stop, BD Biosciences, USA) and Brefeldin A (5 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... or 5-laser LSRFortessa X-20 (all BD Biosciences), a 3-laser Attune NxT (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking with FcBlock antibody (5 mg/ml, BD) for 10 min at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were blocked in 5% skim milk (BD Biosciences) in TBS with 0.1% Tween-20 and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 g/l Bacto yeast extract (BD Biosciences, UK), 10 g/l NaCl (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... and anti–IL-12 (5 µg/mL; BD Biosciences); Treg ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was blocked in 5% skimmed milk (BD) and probed with rabbit polyclonal antibody against Gαq ...
-
bioRxiv - Genomics 2022Quote: ... 5 g Bacto™ peptone (BD, Cat. No.: 9030688), 1 g Bacto™ yeast extract (BD ...
-
bioRxiv - Immunology 2022Quote: ... and CD4–PerCP-Cy5.5 (clone R4-5; BD Biosciences). For intercellular staining ...
-
bioRxiv - Microbiology 2022Quote: ... and 5% horse blood (BD, Franklin Lakes, New Jersey). Antibiotic susceptibility was determined using the bioMérieux Etest® platform (bioMérieux ...