Labshake search
Citations for Becton, Dickinson and Company :
1451 - 1500 of 3693 citations for 7 16 DIHYDROBENZO A BENZO 5 6 QUINO 3 2 I ACRIDINE 9 18 DIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ...
-
bioRxiv - Biochemistry 2022Quote: ... Flotillin-2 (1:1000, BD Biosciences, 610383), Caveolin-3 (1:4000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Thrombospondin (TSP)-2 (1:100, BD Biosciences), Hevin (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... IL-2 BB700 (1:25, BD, 566405), IFNγ (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD3-APC (SP34-2, BD Pharmingen) and anti-IFN-γ-PE (4S.B3 ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Cell Biology 2019Quote: NHEM cells were trypsinized and seeded at density of 1X105cells/well in 6-well plate (BD Bioscience) and incubated overnight with antibiotic containing M254 (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Concentrations of IL-6 and IL-10 were interpolated using FCAP Array software (v. 3.1, BD Biosciences) from standard curves ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Developmental Biology 2021Quote: ... non-adherent bone marrow cells were seeded in triplicate in 6-well collagen-coated plates (BD Biosciences) at a density of 1×105 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... P was analyzed (as molybdate reactive P) in the 6 extracts (referred to as H2O-P, BD-P ...
-
bioRxiv - Immunology 2020Quote: ... then stained with the antibodies described in Supplementary Table 6 and analysed on the LSRII (BD Bioscience). Data were analysed with the FlowJo v10.4.2 software (FlowJo LLC).
-
bioRxiv - Microbiology 2020Quote: ... and IFN-γ secreted by splenocytes of C57BL/6 mice were determined using ELISPOT kits (BD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Stained cells were analyzed using a BD LSRII Fortessa equipped with FACSDiva software (Version 6) (BD Pharmingen). Samples were acquired using Fortessa’s HTS plate reader option at an event rate below 20,000 events/s ...
-
bioRxiv - Microbiology 2023Quote: ... a final concentration of 10 μg/ml Brefeldin A and 6 μg/ml Golgi-Stop (BD Biosciences) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Immunology 2021Quote: ... (1:1,200) (eBioscience) for sorting of mTEChi/lo (CD45-Ly51-I-A/Ehigh/low) on a FACSAria III instrument (BD Bioscience), as previously described18,39.
-
bioRxiv - Bioengineering 2019Quote: ... Stretched cultures were encapsulated in an extraceullular matrix (ECM) comprised of 3.0 mg/mL rat-tail collagen type I (BD Biosciences) supplemented with 1.0 ug/mL 2.5S nerve growth factor (BD Biosciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were analysed with an LSR II instrument and isolated with an Aria I fluorescence-activated cell sorter (BD Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were washed twice with ice-cold PBS and FITC-annexin-PI was done as per manufacturer’s instruction using FITC Annexin V Apoptosis Detection Kit I (Cat. 556547, BD Biosciences). Flow cytometry was performed using a BD LSR II flow cytometer of the Flow Cytometry Core Facility at The Bloomberg School of Public Health ...
-
bioRxiv - Microbiology 2020Quote: ... washed twice with cold PBS and then re-suspended in 1x binding buffer(Apoptosis detection Kit I # 556578, BD Pharmingen) at 1x 106 cells/ml ...
-
bioRxiv - Physiology 2021Quote: ... into two cell populations: CD19+CXCR3+ITGB1+ and CD19+CXCR3-ITGB1-using the BD Aria I cell sorter (BD Biosciences). The cells were centrifuged at 300g ...
-
bioRxiv - Cancer Biology 2019Quote: ... both floating and adherent cells were harvested and analysed with the FITC Annexin V Apoptosis Detection Kit I (BD Bioscience), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... we incubated the coverslips or plates O/N at +4 °C with 0.1 mg/ml of collagen I from rat tail (BD Biosciences) in 0.25% acetic acid ...
-
bioRxiv - Immunology 2021Quote: ... Single cell analysis was performed by flow cytometry and the histogram-overlay graphed (LSRFortessa I; FlowJo xV0.7 software; BD Biosciences). The mean fluorescence intensity (MFI ...
-
bioRxiv - Immunology 2021Quote: ... Single cell analysis was performed using flow cytometry and the histogram-overlay graphed (LSRFortessa I; FlowJo xV0.7 software; BD Biosciences). The MFI ratio between LPS MFI and PBS MFI was calculated.
-
bioRxiv - Cancer Biology 2020Quote: ... to analyze cell cycle distribution and we quantified apoptotic cells with PE-AnnexinV Apoptosis Detection Kit I (559763, BD Pharmingen).
-
bioRxiv - Cancer Biology 2021Quote: Viability of AML cells was measured using FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, San Jose, CA, USA). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: MLO-Y4 osteocytes (21) were cultured on collagen-coated plates (rat tail collagen type I, BD Biosciences, San Jose, CA) in MEM-a (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... specificity of the cells was tested by staining with tetramers generated from HLA-I easYmer and streptavidin-PE (BD Biosciences) according to the manufacturer’s instructions (immunAware) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed twice with ice-cold PBS and FITC-annexin-PI was done as per manufacturer’s instruction using FITC Annexin V Apoptosis Detection Kit I (Cat. 556547, BD Biosciences). Flow cytometry was performed using a BD LSR II flow cytometer of the Flow Cytometry Core Facility at The Bloomberg School of Public Health ...
-
bioRxiv - Cell Biology 2023Quote: Cell cycle and cell apoptosis assays were performed according to the manufacturer’s instruction (FITC Annexin V Apoptosis Detection Kit I, BD, 556547; PI/RNase staining buffer, BD, 550825).
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...