Labshake search
Citations for Becton, Dickinson and Company :
1351 - 1381 of 1381 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cell Biology 2021Quote: ... The ZsGreen-ODC (ornithine decarboxylase) cells were previously generated by transfection of MelJuSo cells with the ZsProsensor-1 plasmid (BD Bioscience Clontech)20 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% dextrose) when containing no plasmids and in synthetic defined (SD) media (0.67% yeast nitrogen base without amino acids [BD Difco], 2% dextrose) supplemented with the appropriate yeast synthetic drop-out medium supplement when plasmid maintenance was required (SDΔW-without tryptophan ...
-
bioRxiv - Systems Biology 2024Quote: ... whereas donor strains with the appropriate donor plasmids were pinned onto YPD+G418 plates (10 g/l yeast extract (BD Biosciences, 212750), 20 g/l peptone (BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: Cells from the cell line U3065 obtained from the Human Glioma Cell Culture (HGCC) resource [35] were suspended in stem cell medium and plated on 384 well plates (BD Falcon Optilux TC #353962) coated in laminin ...
-
bioRxiv - Cancer Biology 2020Quote: ... Enumeration of human CD45+ cells in spleen and bone marrow was performed by flow cytometry after staining with BV605-conjugated human-specific CD45 antibody (clone HI30, BD Biosciences, San Jose, CA) using a BD LSRII flow cytometer (BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: ... Single-cell suspensions at 5 × 107 cells per ml were stained with a cocktail of fluorochrome conjugated human antibodies (BD Biosciences, San Jose, CA), anti-human IgG APC ...
-
bioRxiv - Bioengineering 2020Quote: ... Coated beads were then incubated with anti-human CD63 (eBioscience, San Diego, CA) and analysed with a BD AccuriTM C6 (BD Biosciences, San Jose, CA).
-
bioRxiv - Immunology 2022Quote: ... and incubated for 30 min at 4°C with a cocktail of mouse anti-human antibodies: CD19 Alexa 700 (HIB19, BD Biosciences, San Jose, CA), CD21 BV421 (B-ly4 ...
-
bioRxiv - Genetics 2020Quote: ... Cells were stimulated at 1×106 cells/ml with 10 μg/mL soluble Leishmania antigen (SLA) plus 1 μg/mL purified NA/LE anti-human CD28 (clone CD28.2, BD Biosciences, San Jose, CA, USA) at 37°C / 5% CO2 for 15 h and subsequently incubated in the presence of brefeldin A (BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... the cells were co-cultured in R10 medium alone or in presence of K562 cells for 2 hours in the presence of anti-human CD107a (FITC or Brilliant Violet 421, H4A3, BD Biosciences, San Jose, Calif.).
-
bioRxiv - Biochemistry 2020Quote: ... and TNF in the supernatants was determined by using Cytometric Bead Array (CBA) - Human Inflammatory Cytokines Kit (551811, BD Biosciences, San Jose, CA, USA), that allows the determination of the indicated human cytokines simultaneously ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Whole blood was collected from human volunteer donors with informed consent in 8 to 10 BD Vacutainer CPT 8 ml tubes (BD Biosciences, San Jose, CA). The blood samples were mixed immediately prior to centrifugation by gently inverting tubes 8-10 times ...
-
bioRxiv - Immunology 2021Quote: ... harvested and stained for flow cytometry as described (37) using antibodies to human surface antigens: CD4-APCH7 (SK3, BD Biosciences Franklin Lakes, NJ, USA), CD8-PerCP (SK1 ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 μl of each sample was analysed in duplicates using the BD™ CBA Human Soluble Protein Master Kit (#556264; BD Biosciences, CA, USA) alongside the BD™ CBA Human Flex Sets for interleukin 1ß (IL-1ß ...
-
bioRxiv - Immunology 2023Quote: ... a total of 50 ml of whole human blood was collected by a trained phlebotomist from healthy donors in BD Vacutainer® EDTA tubes (BD Vacutainer®, USA). This was previously approved by the RVC’s Ethics and Welfare Committee (URN 2019 1916-3).
-
bioRxiv - Molecular Biology 2023Quote: ... Evaluation of proliferation in tissues using antibodies against Ki67 or BrdU (anti-human Ki67 and anti- BrdU monoclonal antibodies; Thermo-Fisher Scientific and BD BioSciences, USA, respectively) was performed as previously described {GarciaMelendrez:GKcY05su } ...
-
bioRxiv - Cancer Biology 2023Quote: Ba/F3 cells expressing human MPL protein that were either cultured normally or treated with drugs were harvested and stained for surface MPL using PE-conjugated anti-human MPL antibody (BD Pharmingen 562159,1:50 dilution) in staining buffer for 30 min at 4°C.
-
bioRxiv - Immunology 2024Quote: ... blocked with 2% BSA in phosphate buffer pH=7.4 for 30min at RT and incubated with mouse anti-human LAMP1 (BD Biosciences, Franklin Lakes, NJ, USA) for 1h at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were then stained for 30min at 4°C with the following antibodies: monoclonal anti-human CD33 V450 (WM53; BD Biosciences, San Jose, CA, USA); HLA-ABC FITC (W6/32 ...
-
bioRxiv - Immunology 2019Quote: Cytokine levels in clinical samples were assessed using the following commercially available kits: i) human Th1/Th2/Th17 Cytokine Kit (BD Bioscience, San Jose, CA, USA) based on the principle of cytometric bead array (CBA ...
-
bioRxiv - Biochemistry 2020Quote: ... an affinity-purified mouse mAb that recognizes an epitope in the C-terminal NAD binding and catalytic domain of human PARP1 (clone 7D3-6, BD Biosciences #556493; 1:500 dilution); anti-cc-PARP1 ...
-
bioRxiv - Immunology 2020Quote: ... for macrophages and pDC’s were identified by co-staining of PE conjugated mouse anti-human CD123 (BD Biosciences, USA, 1:20, 37°C for 2h) and mouse anti-human HLA-DR antibody (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and the cell suspensions purity was higher than 90% as assessed by fluorescent staining with PhycoErytherin (PE)-anti-human CD14 antibody (BD Biosciences, San Diego, CA, USA) using a Floid Cell Imaging Station (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... IgA and IgM antibodies were quantified in the CVL specimens using the human immunoglobulin cytokine bead array (CBA) flex set assay (BD Biosciences, San Jose, CA, USA). The Ig CBA assay was performed as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The following mouse and human monoclonal antibodies were utilized for virion capture assays: anti-PSGL-1 and anti-mouse IgG (BD Biosciences, Cat# 556053 and 557273) and anti-gp120s (clones 2G12 and PG9 acquired from the NIH ARP ...
-
bioRxiv - Cancer Biology 2023Quote: ... to isolate GFP+ and GFP-populations from primary tumors after DAPI staining for live cells and from mice metastatic organs after labeling with human CD298-PE (BD, Cat#749741, clone P-3E10) and DAPI for human melanoma and live cells ...
-
bioRxiv - Immunology 2024Quote: ... the cells were washed twice with PBS as described above and the cell pellet was resuspended into 25 µl of FACS buffer (1% FBS in PBS) containing human FC block (BD Bioscience, # 564219; 1:200 dilution) and either 200 nM MLi-2 (synthesised by Natalia Shpiro ...
-
bioRxiv - Biophysics 2024Quote: ... transferred in a V-bottom 96-well plates and co-cultured with K562 cells (ATCC) at 1:1 effector-to-target ratio in the presence of mouse anti-human CD107a Alexa Fluor 647 (BD Bioscience, clone H4A3, 2 uL/well) for 6 hours at 37°C ...
-
bioRxiv - Immunology 2020Quote: Multiscreen ninety-six well plates were coated overnight with 100 μl per well of 5 μg/ml anti-human interferon-γ (IFN-γ) (B27; Becton, Dickinson and Company, Franklin Lakes, NJ) in endotoxin-free Dulbecco’s-PBS (D-PBS) ...
-
bioRxiv - Bioengineering 2024Quote: ... for 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail: anti-human CD19 (Becton, Dickinson and Company, BD, Franklin Lakes, NJ, USA, cat.: 562440), anti-human CD20 (BioLegend ...