Labshake search
Citations for Becton, Dickinson and Company :
1351 - 1400 of 3459 citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... and DRAQ-5 were measured with an LSRII Flow cytometer (BD Biosciences; San Jose, CA). Data were gated on FSC-A vs ...
-
bioRxiv - Microbiology 2021Quote: ... A single colony was then sub-cultured in 5 mL Luria-Bertani (LB; BD Bioscience) and incubated for 16-18 h at 35°C ...
-
bioRxiv - Microbiology 2019Quote: ... 5% Skim Milk Protein at 1/2x Tryptic Soy Broth (Becton, Dickinson and company, France) medium and 100 μL of F ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcutaneously inoculated with 5 × 106 cells in 1:1 mixture with Matrigel (BD Biosciences). After 3 weeks ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 mL of blood were extracted using a lavender topped vacutainer (BD Vacutainer tubes, UK) which uses dipotassium/tripotassium salts of EDTA as an anticoagulant ...
-
Rbx1 Cullin-Ring ligase E3 and Ube2m neddylation E2 differentially governs the fitness of Treg cellsbioRxiv - Immunology 2020Quote: ... cells were stimulated for 5 h with leukocyte activation cocktail of GolgiPlug (BD Pharmingen, 550583). Antibodies were all from eBioscience ...
-
bioRxiv - Immunology 2020Quote: ... Then cells were first stained with Percp conjugated anti-monkey CD4 (RM4-5, BD, 561115), Percp conjugated anti-monkey CD8a (RPA-T8 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were washed and incubated 5 min with 20µg/mL of propidium iodide (BD Bioscience) and then directly analyzed with LSR Fortessa X-20 flow cytometer ...
-
bioRxiv - Immunology 2021Quote: Digested wound tissue was mechanically disrupted for 5 min using the Medimachine System (BD Biosciences). Cells were passed through 70 µm and 40 µm cell strainer and washed with 1% bovine serum albumin and 2 mM EDTA in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... The culture was mixed with equal volume of 5% hog mucin (Becton, Dickinson and Company) and 0.5 ml of the bacterial suspension (1-5 × 106 cfu/mouse ...
-
bioRxiv - Microbiology 2022Quote: Strains were inoculated from freezer stocks into 5 mL Mueller Hinton Broth (MHB) (BD Bacto) and incubated overnight at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... while the CD4 RM4-5 BV421 Rat Anti-mouse CD4 antibody (BD Biosciences, CAT#100543) and Rat Anti-mouse CD8 antibody (Invitrogen ...
-
β-catenin programs a tissue-specific epigenetic vulnerability in aggressive adrenocortical carcinomabioRxiv - Cancer Biology 2022Quote: ... Cells (5 × 104) were resuspended in PBS mixed with Matrigel Basement Membrane Matrix (BD Biosciences) at 1:1 ratio and injected into subcutaneous tissue in the NSG mouse flank ...
-
bioRxiv - Immunology 2024Quote: ... B cells were collected and stained with 5 μL of 7-AAD (559925, BD Pharmingen) at room temperature for 10 min ...
-
bioRxiv - Genetics 2024Quote: FACS was performed using a Becton Dickinson Aria II equipped with 5 lasers (BD bioscience). Gates were drawn as determined by negative controls to separate positive and negative populations for each florescent protein ...
-
bioRxiv - Microbiology 2024Quote: ... 5 × 104 cells in the f1 to f6 subpopulations were sorted into PBS by BD FACS Melody (Becton Dickinson) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 × 105 cells in the f1 to f6 subpopulations were sorted into PBS by BD FACS Melody (Becton Dickinson) ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies used were PerCP-cy5.5 rat anti-mouse CD4 (#55095, clone: RM4-5, BD Biosciences), PE-Cy7 rat anti-mouse CD45R/B220 (#552772 ...
-
bioRxiv - Molecular Biology 2022Quote: ... clones were isolated as previously described (5) and screened using a FACSCalibur cell analyzer (BD) to select a clone with high tdTomato expression ...
-
bioRxiv - Immunology 2022Quote: ... CD45+ cells were sorted directly into 5% FBS using a FACS AriaFusion cell sorter (BD). Cell nuclei were isolated from the sorted CD45+ cells using Nuclei Isolation for Single Cell ATAC Sequencing Protocol (CG000169 Rev D) ...
-
bioRxiv - Immunology 2022Quote: ... CD45+ cells were sorted directly into 5% FBS using a FACS AriaFusion cell sorter (BD). Cells from each sample were counted before 16,000 cells per sample were loaded on the 10x chromium chip (Chromium platform,10x Genomics) ...
-
bioRxiv - Immunology 2023Quote: ... Digested wound tissue was mechanically disrupted for 5 min using the Medimachine System (BD Biosciences). Cells were passed through 70µm and 40µm cell strainer and washed with ice-cold PBS/1% BSA/2mM EDTA ...
-
bioRxiv - Plant Biology 2024Quote: ... pH 7.5) containing 0.1% Tween 20 (TBST) and blocked with 5% Difco Skim Milk (BD) overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then covered with 5 µl of Matrigel (BD Bioscience, San Jose, CA, USA) and incubated for 7 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... MLO-Y4 cells were cultured as described on plastic tissue culture plates coated with rat-tail collagen I (BD). These cells are cultured in 2.5% heat-inactivated Fetal Bovine Serum (Characterized ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Cell Biology 2019Quote: ... Established iSML iPSCs were maintained in Nutristem-XF (Biological Industries) in plates coated with hESC-qualified matrigel (BD Biosciences) and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2019Quote: ... Rat hippocampal cells were plated on poly-D lysine coated 96 well imaging plates (BD Biosciences, San Jose, CA) (~16 plates per week ...
-
bioRxiv - Microbiology 2021Quote: ... Single colony was stab-inoculated with a sterile toothpick on the surface of LBNS plates (0.3% BD Bacto Agar). Plates were incubated upright at 37 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on PDL-coated 96-well microplates (7000 cells per well; black/clear imaging plate, BD Falcon 353219). RGCs were cultured in serum-free medium (Neurobasal/Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The diluted whole lung or cell lysate were then separately plated on Middlebrook 7H10 agar plates (BD Bioscience, #295964) along with streptomycin (50μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37 °C in anaerobic chambers with GasPak™ EZ Gas Generating Container System (BD Diagnostics) to maintain the anaerobic condition during the incubation for indicated time points ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 batches of 24 eggs each were placed in wells of 6-well plates (Falcon, BD Biosciences, Allschwil, Switzerland). Ten mL of diluted milt of 2 males each was prepared such that each male was represented with the same concentration of active sperm (25 Mio/mL ...
-
bioRxiv - Microbiology 2021Quote: ... 30 and 38 community composition was measured by plating on nutrient agar plates (5g/L peptone BD difco, BD Bioscience ...
-
bioRxiv - Immunology 2020Quote: ... CD19+ Pf+ or HA+ B cells were single cell–sorted into 96-well plates using a FACSAria II (BD). Index sorting was used to determine isotype and B cell subsets by IgM ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed with PBS prior to the addition of 100 μL/well TMB substrate (BD Biosciences). Fifteen minutes after the addition of substrate ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample (100 μL) was then cultured in plates of potato dextrose agar (1% Difco PDA; BD company, France) and carboxymethyl cellulose (1% CMC ...
-
bioRxiv - Microbiology 2022Quote: ... They were cultivated on PDA plates at 25°C for growth and in potato dextrose broth (BD Difco™) culture for genomic DNA extraction as previously reported41 ...
-
bioRxiv - Cancer Biology 2021Quote: ... isolated GSCs or GSCs expressing shHAUSP were cultured on plates or coverslips pretreated with the Matrigel (354230; BD Biosciences) and induced for differentiation in serum-containing medium (1% FBS in DME ...
-
bioRxiv - Cell Biology 2022Quote: ... The sorting into 384-well plates was performed with a 100 µm nozzle on BD FACS AriaIII CellSorter (BD BioScience Flow Cytometry System equipped with four lasers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the transwell inserts from the CIM plates were coated with 20 μl of growth-factor-reduced Matrigel (BD Biosciences), at a concentration of 250 μg/ml ...