Labshake search
Citations for Becton, Dickinson and Company :
1301 - 1350 of 3509 citations for Galactose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: GFP expressing PAO1 was provided by the Cannon laboratory and was grown on Soy agar plates (BD, 211043) with 100 μg/mL carbenicillin (Dot Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and the mixture was poured onto a 20 ml 1.5% bottom agar plate (BD Difco 2216 marine broth). For the enrichment ...
-
bioRxiv - Immunology 2024Quote: ... and positive control cells were incubated in plates coated with anti-CD3 (1μg/ml) (clone HIT3a, BD Biosciences) or PHA (2 μg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... C06/C20 microglia were cultured at 1 x 106 cells per well in 6-well plates (BD Falcon), and iMicroglia were cultured at 5 x 104 cells per well in 96-well plates (CellBind) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Alexa Fluor® 647 Mouse anti-CDX-2 (BD Pharmingen, M39-711,). After washes ...
-
bioRxiv - Immunology 2021Quote: ... APC-conjugated anti-IL-2 (clone JES6-5H4; 554429) was purchased from BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... anti-mouse IL-2 PE-CF594 (clone JES-5H4, 1:200, BD Biosciences), and anti-human/mouse granzyme B PE-Cy7 (clone Q1A6A02 ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were resuspended in PBS + 2% FCS and an Influx cell sorter (BD) was used.
-
bioRxiv - Cell Biology 2022Quote: ... bait proteins were captured with antibodies to BAK (Clone# G317-2, BD Pharmingen), MCL-1 (Clone#19C4-15 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed 2 times with PBA before acquisition on a FACSLyric (BD).
-
bioRxiv - Microbiology 2019Quote: ... faecalisJH2-2 were recovered on XLT-4 and enterococcosel (BD Difco, Sparks, MD) agar supplemented with 200 ppm and 512 ppm of nalidixic acid (nal ...
-
bioRxiv - Biophysics 2019Quote: ... 5 g Bacto-yeast extract (BD Difco, cat# 212720, CAS: 8013-01-2), 10 g NaCl (Fisher BioReagents ...
-
bioRxiv - Developmental Biology 2019Quote: ... Figure 1 and figure 2: CD235a-PeCy7 (1:100, BD, GA-R2(HRI2)) ...
-
bioRxiv - Microbiology 2019Quote: ... SM-based solid media contained 2 % Bacto Agar (BD Biosciences, Franklin Lakes, NJ). S ...
-
bioRxiv - Immunology 2020Quote: ... mouse anti-Ki67 (BD Biosciences, USA, 1:50, 2 h at 37°C) was used for detection of actively proliferating cells ...
-
bioRxiv - Microbiology 2020Quote: ... then surface stained with CD3 Brilliant Violet (BV) 711 (Sp34-2, BD Biosciences), CD4 PerCPCy5.5 (L200 ...
-
bioRxiv - Microbiology 2021Quote: ... and subjected to surface staining using anti-CD3 APC-Cy7 (SP34-2; BD), anti-CD4 FITC (M-T477 ...
-
bioRxiv - Cell Biology 2020Quote: ... After 2 additional days free-floating EBs were transferred on Matrigel (BD Biosciences) coated plates and cultured in neural medium (DMEM/F12-GlutaMAX containing 2% B27 with Vitamine A ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-C-terminal binding protein 2 (CtBP2; BD Biosciences 612044, 1:200), rabbit anti-cleaved Caspase-3 (Cell Signaling Technology 9661 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were analyzed for viability with the LSR-2 flow cytometer (BD Bioscience). Data was analyzed using Kaluza software (Beckman Coulter).
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed using 2% paraformaldehyde before acquisition on Symphony cytometer (BD Biosciences). Analyses were performed using FlowJo v10.7.1 software.
-
bioRxiv - Immunology 2019Quote: ... The following antibodies were used: anti-CD3–AF700 (clone SP34-2, BD Biosciences), anti-CD4–PerCP-Cy5.5 (clone L200 ...
-
bioRxiv - Neuroscience 2021Quote: ... As only one subscale was available for Datasets 1 (MR) and 2 (BD), these scores provided a proxy for NVIQ ...
-
bioRxiv - Bioengineering 2020Quote: ... cells were trypsinized and washed 2 x stain buffer (FBS) (BD Biosciences®) and stained using the BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD Biosciences®) ...
-
bioRxiv - Immunology 2022Quote: ... quenched type 2 RNase H-specific substrate without addition of RNase HII (BD), quenched type 2 RNase H-specific substrate with addition of heat-inactivated cell lysate (BD + h.i ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells (2 × 106 cells/100 μl) were mixed with Matrigel (100 μl) (BD) on ice and hypodermically injected into NOD-SCID mice using a 22-gauge needle ...
-
bioRxiv - Immunology 2021Quote: ... and stained with an antibody cocktail of CD3 (clone SP34-2, BD Biosciences), CD4 (clone OKT4 ...
-
bioRxiv - Immunology 2021Quote: ... and cells were suspended in 2% FBS/DPBS buffer with Fc Block (BD) for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... Subsequently cells were stained with 2 μl of anti-CD8-BUV805 (BD, 564912), 1 μl of anti-CD4-APC-H7 (BD ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed and permeabilized in 2 × FACS BD Lysis Solution (BD Biosciences) with 0.08% Tween20 in ddH2O for 10 min at RT in the dark ...
-
bioRxiv - Immunology 2020Quote: ... NHP cells were stained with the following antibodies: CD3 Alexa700 (SP34-2; BD), PD-1 BV421 (EH12.2H7 ...
-
bioRxiv - Immunology 2019Quote: ... The following antibodies used were: anti-CD3–PE (clone SP34-2, BD Biosciences), anti-CD4–PerCP-Cy5.5 (clone L200 ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 2% BSA and stained with antibodies against CD19-PE (BD-555413), CD3-BV510 (BD-564713) ...
-
bioRxiv - Microbiology 2020Quote: ... tularensis was streaked onto Cystine Heart Agar supplemented with 2% Hemoglobin (CHAB) (BD) and incubated at 37°C for 72 hours ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with antibodies for IL-2 (BD Biosciences, 1:100, JES6-5H4) for 30 minutes at room temperature and analyzed in flow cytometry.
-
bioRxiv - Physiology 2024Quote: ... MEAs were coated with Matrigel (2% v/v) (BD Biosciences, San Diego, CA) as described [11b ...
-
bioRxiv - Immunology 2024Quote: ... soluble anti-CD28 (2 µg/ml, clone 37.51, BD Biosciences, San Diego, CA), recombinant IL-4 (20 ng/ml ...
-
bioRxiv - Genomics 2024Quote: ... 2 µM of 5.6-carboxyfluorescein diacetate succinimidyl ester or CFSE (BD Biosciences, USA) was added to the cells and incubated for 5 minutes at 370C ...
-
bioRxiv - Immunology 2023Quote: ... Surface Abs were used as follows: CD3-V450 (SP34-2, V450, BD Biosciences), CD4-APC (L200 ...
-
bioRxiv - Immunology 2022Quote: ... Table 1 and 2 BD Fortessa™ Flow Cytometer (BD Biosciences, Heidelberg, Germany) was used to perform flow cytometry ...
-
bioRxiv - Neuroscience 2023Quote: ... Blood was transferred to a sterile 2 ml serum blood collection tube (BD Vacutainer ...
-
bioRxiv - Microbiology 2023Quote: ... cells were incubated with 2 μg/mL IFNGR1-neutralizing antibody (BD Bioscience #557531) or an isotype control (BD Bioscience #554721 ...
-
bioRxiv - Immunology 2023Quote: ... The following antibodies were used: anti-mouse CD3 (clone 17A-2, BD Biosciences), CD11c (clone HL3 ...
-
bioRxiv - Immunology 2023Quote: ... The following antibodies were used: anti-mouse CD3 (clone 17A-2, BD Biosciences), CD45 (clone 30-F11 ...
-
bioRxiv - Immunology 2023Quote: ... TCR stimulation was measured by IL-2 ELISA on culture supernatant (BD 555148).
-
bioRxiv - Cell Biology 2024Quote: ... MEAs were coated with Matrigel (2% v/v) (BD Biosciences, San Diego, CA) prior to seeding of cells ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were then stained in FACS buffer with anti-pMEK1/2 (BD Biosciences) and anti-pERK1/2 (BD Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...