Labshake search
Citations for Becton, Dickinson and Company :
1251 - 1300 of 1307 citations for Human PRPF31 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... A target primer panel was constructed by combining a commercial predesigned Human T Cell Expression Primer Panel (BD Biosciences, 259 target primers) with our custom-designed primer panel (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... 96-well plates were pre-coated with 10 ng/mL anti-CD3 mAb at 4°C overnight (Purified NA/LE mouse anti-human CD3, BD Cat# 557052). Three-fold serial dilutions of either IL-7 or a test compound were added to the cells and incubated for 4 days at 37°C ...
-
Tracer-based metabolomics for profiling nitric oxide metabolites in a 3D microvessel-on-a-chip modelbioRxiv - Cell Biology 2023Quote: ... Permeabilization was followed by blocking cells using 5% BSA in HBSS+ for 30 min and incubated with the primary antibody solution - Mouse anti-human CD144 (1:150; 555661, BD Biosciences, USA) for overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: The purity of each NK population was checked before and after cell sorting and routinely by flow cytometry with anti-human CD16-BV421 (clone 3G8, BD Pharmagen, France), anti-human CD56-PeCy7 (clone B159 ...
-
bioRxiv - Immunology 2023Quote: ... were diluted 1:50 in PBS-10% FBS and IL-2 concentration was determined by ELISA assays using the OptEIA Human IL-2 ELISA commercial kit (BD Biosciences, USA) and revealed with TMB substrate (Thermofisher ...
-
bioRxiv - Immunology 2023Quote: ... Cytometric Bead Array using enhanced sensitivity flex sets of human IL-2/IFN- γ/TNF- α was done following manufacturer’s instruction (BD Biosciences). Alternatively ...
-
bioRxiv - Immunology 2023Quote: ... and co-cultured with human CD8+ T cells at 1:1 E:T ratio in the presence of anti-CD107a-APC mAb (BD Biosciences, CA, USA). After 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... A population of parasites expressing the co-transfected Cas9-GFP-containing plasmid were sorted by flow cytometry using a BD Influx cell sorter (BD Biosciences). ~70% of these parasites expressed the HA peptide by IFA.
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with one plasmid derived from pPC86 (GAL4-activation domain, AD (‘Prey’)) and pPC97 (GAL4-DNA-binding domain, BD (‘Bait’)) (Chevray and Nathans ...
-
bioRxiv - Immunology 2022Quote: Shigella flexneri 2a WT strain 2457T and avirulent plasmid-curated strain BS103 were grown from frozen stocks (−80°C) on Tryptic Soy Agar (TSA) (Difco BD, USA) supplemented with 0.01% Congo Red dye (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... HEK293 cells transfected with ABE plasmids were collected from 6-well plate and analyzed on Becton Dickinson LSR II (BD Biosciences) to determine GFP-positive cells ...
-
bioRxiv - Microbiology 2023Quote: ... Mtb strain H37Rv with plasmid pSMT3[Phsp60/DsRed] [9] was cultured at 37°C in complete Difco Middlebrook 7H9 Broth (BD Biosciences), supplemented with 10% ADC (BD Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: Stm strain SL1344 with plasmid pMW211[C.10E/DsRed] [20] and strain 12023 with plasmid pluxCDABE [6] were recovered from frozen glycerol stock and cultured in Difco Luria-Bertani (LB) Broth (BD Biosciences) containing 100 µg/ml ampicillin (Merck ...
-
bioRxiv - Genomics 2022Quote: ... single cells expressing GFP (expressed from the CRISPR plasmid) were sorted into 96-well plates through flow cytometry using a BD FACSAria Fusion (BD Biosciences). Single-cell clones were cultured and tested for successful knockout of RFX7.
-
bioRxiv - Cell Biology 2024Quote: ... organoids were dissociated and mCherry positive cells (marking successful electroporation of the pCAS9-mCherry-Frame+1 plasmid) were sorted on ARIAIII sorter (BD Biosciences) and seeded in Matrigel with normal organoid media supplemented with rock inhibitor Y-27632 (10 μM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The antibodies used for the flow cytometry analysis of the cell surface markers were: anti-human CD11b (740965, BD OptiBuild™, 1:100), anti-human CD14 (11-0149-42 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were incubated with a fluorescein isothiocyanate (FITC)-conjugated mouse anti-human CD31 antibody (1:50; BD Pharmingen, San Diego, CA, USA) for 30 min at room temperature followed by 3 washes with phosphate buffered saline (PBS) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were resuspended in sorting buffer (2% FBS and 1% Penicillin-Streptomycin in DMEM) and blocked with human FcR blocking reagent (Cat#564220; BD; used 1:50) for 10 minutes at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... and the purity of monocytes was evaluated by fluorescent staining with PhycoErytherin (PE)-anti-human CD14 antibody (BD Biosciences, San Diego, CA, USA) using a Floid Cell Imaging Station (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Antibody concentrations were as follows: alveolar macrophage membranes were stained using CD206 PE-CF594 (Mouse Anti-Human CD206, BD Biosciences; catalogue number: 564063) at a concentration of 4µL in a 50μL final staining volume per section ...
-
bioRxiv - Cell Biology 2019Quote: The following antibodies were used for fluorescence microscopy: mouse IgG2B anti-human DC-SIGN at 2 μg/ml (DCN46, BD Biosciences, Breda, Netherlands), mouse IgG1 anti-human AZN-D1 at 2 μg/ml (Geijtenbeek et al. ...
-
bioRxiv - Immunology 2021Quote: NK cells and cancer cells were cocultured at 10:1 ratio and supplemented with 20ul of PE mouse anti-human CD107a antibody (BD Pharmingen™, #555801) in a total volume of 220ul in a 96 well plate at 37C incubator for 90 minutes ...
-
bioRxiv - Immunology 2020Quote: ... Cells were incubated for 45 min with the indicated antibodies: AlexaFluor® 647 anti-human CD107a antibody (diluted at 1/100, clone H4A3; BD Pharmingen TM), anti-human Perforin (10µg/ml ...
-
bioRxiv - Immunology 2021Quote: ... cells were resuspended in 50 µL Perm/Wash buffer containing a cocktail of anti-human antibodies including IFNγ BV480 (BD, 566100, clone B27), TNFα BV605 (Biolegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human platelets in the obtained blood were identified using APC-labeled polyclonal rabbit anti-human (h) CD41 and/or CD42b (BD Pharmingen, 1:100) and fluorescein isothiocyanate (FITC)-labeled polyclonal rabbit anti-mouse (m ...
-
bioRxiv - Cancer Biology 2023Quote: ... 200 μL per 1x10e6 cells) with human IgG-Fc block (1:100) followed by the incubation with streptavidin-magnetic bead particles (BD Biosciences, Ref#557812) at 50 μL per 1x10e6 cells ...
-
bioRxiv - Bioengineering 2024Quote: ... for 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail: anti-human CD19 (Becton, Dickinson and Company, BD ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained at room temperature for 1 hour using a PE labeled mouse anti-IDO1 antibody (12-9477-42, Thermo, Waltham, MA) or a BV786 labeled mouse anti-human HLA-DR antibody (564041, BD, Franklin Lakes, NJ) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cell Biology 2021Quote: ... The ZsGreen-ODC (ornithine decarboxylase) cells were previously generated by transfection of MelJuSo cells with the ZsProsensor-1 plasmid (BD Bioscience Clontech)20 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% dextrose) when containing no plasmids and in synthetic defined (SD) media (0.67% yeast nitrogen base without amino acids [BD Difco], 2% dextrose) supplemented with the appropriate yeast synthetic drop-out medium supplement when plasmid maintenance was required (SDΔW-without tryptophan ...
-
bioRxiv - Cancer Biology 2021Quote: Cells from the cell line U3065 obtained from the Human Glioma Cell Culture (HGCC) resource [35] were suspended in stem cell medium and plated on 384 well plates (BD Falcon Optilux TC #353962) coated in laminin ...
-
bioRxiv - Cancer Biology 2020Quote: ... Enumeration of human CD45+ cells in spleen and bone marrow was performed by flow cytometry after staining with BV605-conjugated human-specific CD45 antibody (clone HI30, BD Biosciences, San Jose, CA) using a BD LSRII flow cytometer (BD Biosciences ...
-
bioRxiv - Immunology 2019Quote: ... Single-cell suspensions at 5 × 107 cells per ml were stained with a cocktail of fluorochrome conjugated human antibodies (BD Biosciences, San Jose, CA), anti-human IgG APC ...
-
bioRxiv - Bioengineering 2020Quote: ... Coated beads were then incubated with anti-human CD63 (eBioscience, San Diego, CA) and analysed with a BD AccuriTM C6 (BD Biosciences, San Jose, CA).
-
bioRxiv - Immunology 2022Quote: ... and incubated for 30 min at 4°C with a cocktail of mouse anti-human antibodies: CD19 Alexa 700 (HIB19, BD Biosciences, San Jose, CA), CD21 BV421 (B-ly4 ...
-
bioRxiv - Genetics 2020Quote: ... Cells were stimulated at 1×106 cells/ml with 10 μg/mL soluble Leishmania antigen (SLA) plus 1 μg/mL purified NA/LE anti-human CD28 (clone CD28.2, BD Biosciences, San Jose, CA, USA) at 37°C / 5% CO2 for 15 h and subsequently incubated in the presence of brefeldin A (BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... the cells were co-cultured in R10 medium alone or in presence of K562 cells for 2 hours in the presence of anti-human CD107a (FITC or Brilliant Violet 421, H4A3, BD Biosciences, San Jose, Calif.).
-
bioRxiv - Biochemistry 2020Quote: ... and TNF in the supernatants was determined by using Cytometric Bead Array (CBA) - Human Inflammatory Cytokines Kit (551811, BD Biosciences, San Jose, CA, USA), that allows the determination of the indicated human cytokines simultaneously ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Whole blood was collected from human volunteer donors with informed consent in 8 to 10 BD Vacutainer CPT 8 ml tubes (BD Biosciences, San Jose, CA). The blood samples were mixed immediately prior to centrifugation by gently inverting tubes 8-10 times ...
-
bioRxiv - Immunology 2021Quote: ... harvested and stained for flow cytometry as described (37) using antibodies to human surface antigens: CD4-APCH7 (SK3, BD Biosciences Franklin Lakes, NJ, USA), CD8-PerCP (SK1 ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 μl of each sample was analysed in duplicates using the BD™ CBA Human Soluble Protein Master Kit (#556264; BD Biosciences, CA, USA) alongside the BD™ CBA Human Flex Sets for interleukin 1ß (IL-1ß ...
-
bioRxiv - Immunology 2023Quote: ... a total of 50 ml of whole human blood was collected by a trained phlebotomist from healthy donors in BD Vacutainer® EDTA tubes (BD Vacutainer®, USA). This was previously approved by the RVC’s Ethics and Welfare Committee (URN 2019 1916-3).
-
bioRxiv - Molecular Biology 2023Quote: ... Evaluation of proliferation in tissues using antibodies against Ki67 or BrdU (anti-human Ki67 and anti- BrdU monoclonal antibodies; Thermo-Fisher Scientific and BD BioSciences, USA, respectively) was performed as previously described {GarciaMelendrez:GKcY05su } ...
-
bioRxiv - Cancer Biology 2023Quote: Ba/F3 cells expressing human MPL protein that were either cultured normally or treated with drugs were harvested and stained for surface MPL using PE-conjugated anti-human MPL antibody (BD Pharmingen 562159,1:50 dilution) in staining buffer for 30 min at 4°C.
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were then stained for 30min at 4°C with the following antibodies: monoclonal anti-human CD33 V450 (WM53; BD Biosciences, San Jose, CA, USA); HLA-ABC FITC (W6/32 ...
-
bioRxiv - Immunology 2019Quote: Cytokine levels in clinical samples were assessed using the following commercially available kits: i) human Th1/Th2/Th17 Cytokine Kit (BD Bioscience, San Jose, CA, USA) based on the principle of cytometric bead array (CBA ...
-
bioRxiv - Biochemistry 2020Quote: ... an affinity-purified mouse mAb that recognizes an epitope in the C-terminal NAD binding and catalytic domain of human PARP1 (clone 7D3-6, BD Biosciences #556493; 1:500 dilution); anti-cc-PARP1 ...
-
bioRxiv - Immunology 2020Quote: ... for macrophages and pDC’s were identified by co-staining of PE conjugated mouse anti-human CD123 (BD Biosciences, USA, 1:20, 37°C for 2h) and mouse anti-human HLA-DR antibody (Thermo Fisher Scientific ...