Labshake search
Citations for Becton, Dickinson and Company :
1101 - 1150 of 8141 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 2% (w/v) Bacto peptone (BD Biosciences), and 2% (w/v ...
-
bioRxiv - Immunology 2021Quote: ... CD3 APC-Cy7 (clone SP34-2, BD Biosciences Cat# 557757 ...
-
bioRxiv - Immunology 2021Quote: ... CD3 Cy7APC (clone SP34-2, BD Pharmingen). Biotinylated prefusion-stabilized spike (S-2P ...
-
bioRxiv - Immunology 2020Quote: ... from Biolegend and CD138-APC (281-2) from BD Biosciences.
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μg/ml Laminin (BD Bioscience) in DMEM/F12 medium supplemented with 1X B27 ...
-
bioRxiv - Immunology 2021Quote: ... and 2 μg/ml anti-CD28 (BD) in the presence of 20 ng/ml IL-6 (PeproTech) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v galactose (BD Biosciences 216310)) at an OD600 of 0.3 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), and 2% w/v raffinose (Becton Dickinson 217410)) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), 2% w/v galactose (BD Biosciences 216310) ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV421 (BD, 563259), 1 μl of SA-BUV615 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV480 (BD, 564876), 2 μl of SA-BV421 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV605 (BD, 563260), 2 μl of SA-BV480 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BUV395 (BD, 564176), 0.4 μl of SA-BYG670 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV650 (BD, 563855), 2 μl of SA-BV605 (BD ...
-
bioRxiv - Immunology 2021Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (Clone GK1.5 ...
-
bioRxiv - Genomics 2021Quote: ... Panel 2: CD206 (19.2, PE, 555954 BD), CD36 (SMΦ ...
-
bioRxiv - Immunology 2021Quote: ... Surface markers include: CD3 (SP34-2, BD), CD4 (L200 ...
-
bioRxiv - Immunology 2021Quote: ... CD3e (clone SP34-2, BD Biosciences, 557917), CD4 (clone L200 ...
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2024Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (clone GK1.5 ...
-
bioRxiv - Microbiology 2024Quote: ... 2% CHG in 70% Isopropanol (ChloraPrep; BD) was serially diluted with 1X PBS ...
-
bioRxiv - Immunology 2024Quote: ... CD80-BV650 (clone M18/2, BD Bioscience), MHCII-BUV661(clone M5/114 ...
-
bioRxiv - Immunology 2024Quote: ... with 2 μM Golgi Plug (BD Biosciences) added for the last 3 h of stimulation ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-flotillin-2 (BD Biosciences 610384), rabbit anti-CD9 (CST D801A) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) Bacto TM peptone (BD), pH 5.5
-
bioRxiv - Cancer Biology 2024Quote: ... Skim Milk 2 g (BD Cat #232100), Saline solution 0.9% (Sodium chloride ...
-
bioRxiv - Systems Biology 2022Quote: ... coli strain JM109 (1 × 1010 colony-forming units (CFU)/ml) were cultured for various times in 2 ml of 2xYT liquid medium (BD Difco, Cat# 244020) containing various concentrations of pyridoxal 5’ -phosphate (pH adjusted to 7.0) ...
-
bioRxiv - Immunology 2022Quote: ... blood cells were stained in 50 µl 2% FCS RPMI medium with antibodies against CD11C (APC, clone HC3, BD biosciences, dilution 1/100), CD11b (PercPCy5.5 or Pacific Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Systems Biology 2020Quote: ... CSP consists of 1.7 g/L Yeast Nitrogen Base without Amino Acids and Ammonium Sulfate (BD Difco(tm)) ...
-
bioRxiv - Immunology 2022Quote: About 8 ml of blood was collected in acid citrate dextrose (ACD) tubes (Cat. Number 364606, BD Biosciences) for platelet isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mtb was grown in Middlebrook 7H9 supplemented with 10% (v/v) oleic acid/dextrose/catalase supplement (OADC; BD), 0.2% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole blood was collected by venipuncture into acid-citrate-dextrose (ACD) vacutainers (BD Biosciences, Franklin Lakes, NJ, USA). Blood was supplemented with 0.5 µM prostaglandin E1 (Cayman Chemical) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% v/v OADC (Oleic acid, Albumin, Dextrose, Catalase) enrichment medium (BD Biosciences, Franklin Lakes, USA) to logarithmic growth phase (OD600 0.2 - 0.4 ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% v/v OADC (Oleic acid, Albumin, Dextrose, Catalase) enrichment medium (BD Biosciences, Franklin Lakes, USA), 0,2% v/v Glycerol and 0,05% v/v Tween 80 to logarithmic growth phase (OD600 0.2 - 0.4 ...