Labshake search
Citations for Becton, Dickinson and Company :
51 - 100 of 1307 citations for Human PRPF31 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... or human inflammation CBA kit (BD Bioscience #558264 ...
-
bioRxiv - Bioengineering 2022Quote: ... FITC mouse anti-human TCRαβ (BD Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... FITC mouse anti-human CD25 (BD Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... PE mouse anti-human CD69 (BD Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... FITC mouse anti-human CD45RA (BD Biosciences ...
-
bioRxiv - Genomics 2020Quote: ... anti-human IgM/IgD (BD 555778), CD19 (BD 557835) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PE Anti-Human EpCAM (BD biosciences) and Alexa Fluor 647 Anti-Human Notch1 (BD Pharmingen ...
-
bioRxiv - Cancer Biology 2020Quote: ... V450 Anti-Human CD44 (BD Biosciences), PE Anti-Human EpCAM (BD biosciences ...
-
bioRxiv - Cancer Biology 2019Quote: ... human CD3 APC (BD Biosciences-561810) and human CD33 PE (BD Biosciences-555450) ...
-
bioRxiv - Cancer Biology 2019Quote: ... human CD45 BV605 (BD Biosciences-564048), human CD3 APC (BD Biosciences-561810 ...
-
bioRxiv - Cancer Biology 2019Quote: – FITC Mouse Anti-Human CD24 (BD Biosciences ...
-
bioRxiv - Immunology 2020Quote: ... anti-human CD69 (BD Biosciences, FN50), anti-human CD45 (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... anti-human CD56 (BD Biosciences, B159), anti-human CD19 (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... anti-human CD45 (BD Biosciences, HI30), CD4 (Biolegend ...
-
bioRxiv - Immunology 2022Quote: ... and human Fc blocker (BD Bioscience). Then the cells were washed and stained with anti-CD4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-human CD63 (BD Pharmingen, #556019) antibody was then added and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Human BD Fc block (BD Biosciences) was also used for paired blood-CSF staining ...
-
bioRxiv - Immunology 2022Quote: ... and Human FC Block (BD Bioscience) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... EpCAM FITC (human, BD Bioscience #347197), Sema4A PE (human/mouse ...
-
bioRxiv - Immunology 2023Quote: ... anti-human IFN-γ (B27, BD), anti-mouse IFN-γ (XMG1.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD340 (HER2) (#562349, BD), Streptavidin-PE-Cy7 (#557598 ...
-
bioRxiv - Immunology 2023Quote: ... anti-human IFN-γ (BD Biosciences), anti-human IL-6 (Biolegend) ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-human CD33 (BD, cat.: 555450), anti-human CD19 (Biolegend ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-human CD38 (BD, cat.: 555462), anti-human IgD (BioLegend ...
-
bioRxiv - Genomics 2024Quote: ... For the human dataset from BD Rhapsody the noise ratio was calculated the same way than the mouse dataset for both the Gene expression and protein matrices ...
-
bioRxiv - Microbiology 2019Quote: Human erythrocytes were harvested from 10 mL of human blood following treatment in sodium heparin tubes (BD). Whole blood was centrifuged at 500 × g for 10 min at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... Human IFN-γ ELISA Set (555142) and Human IL-2 ELISA Set (555190) were purchased from BD OptEIA™ ...
-
bioRxiv - Cancer Biology 2024Quote: ... double-stranded oligonucleotides encoding short hairpin RNAs (shRNAs) targeting the mouse E-cadherin mRNA were annealed and then cloned into the pSIREN-RetroQ retroviral vector (BD Biosciences; Franklin Lakes, NJ). The shRNA targeting sequence for E-cadherin was 5’-TACATCCTTCATGTGAGAGTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... Slc37a2 plEGFP-C1 plasmid or plasmid vector control were transfected into Amphopack-293 cells (BD Biosciences) to produce viral particles that were used to infect RBL-2H3 cells or RBL-2H3 cells stably expressing serglycin-mCherry ...
-
bioRxiv - Cell Biology 2020Quote: ... Two hybrid plasmid pKBB486 (Crm1-BD) was constructed by PCR amplification of full-length CRM1 using oligonucleotides 5’- TGAAGATACCCCACCAAACCCAAAAAAAGAGATCGAATTCCAGCTGACCACCATGGAAGGAATTTTGGA TTTTTCTAACG-3’ and 5’- TTTTCAGTATCTACGATTCATAGATCTCTGCAGGTCGACGGATCCCCGGGAATTGCCATGTAATCATCAA GTTCGGAAGG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... PerCP/Cy5.5 mouse anti-human CD95 (DX2) and Brilliant Violet 605 mouse anti-human CD28 (28.2) (BD Biosciences); Phycoerythrin (PE ...
-
bioRxiv - Immunology 2022Quote: ... The Perm B solution contained PE anti-human MIP-1β and FITC anti-human IFNγ (both from BD) for intracellular cytokine staining ...
-
bioRxiv - Immunology 2022Quote: For analysis of various thymus stromal cell populations human samples were blocked with human Fc-block (BD Bioscience) for 10 minutes at 4°C and then stained with Lineage cocktail-FITC ...
-
bioRxiv - Immunology 2022Quote: ... 2 µl anti-human CD38 PE-Cy7 and 0.5µl anti-human CD3 BB700 (all antibodies sourced from BD). Surface staining incubation was performed at 4°C for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mouse or human RIPK1 (BD Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... and PE mouse anti-human CD62L (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... CD4 (RPA-T4, BD Biosciences, for human), CD45 (30-F11 ...
-
bioRxiv - Immunology 2022Quote: ... mouse α-human CD79α-BV421 (BD 566225); and mouse α-pig CD172α-FITC (BioRad MCA2312F).
-
bioRxiv - Genomics 2019Quote: ... and anti-human PE-Ikaros (BD Biosciences). Fixation ...
-
bioRxiv - Immunology 2021Quote: ... Alexa647 mouse anti-human GLUT1 (BD Biosciences), human TRAIL R1/TNFRSF 10A PerCP-conjugated antibody (R&D Systems) ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-human CD247 pTyr142 (Mouse, BD Biosciences), and anti-human GAPDH (Rabbit ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-human PSGL1 BV421 (BD # 563961) for 30 min at RT.
-
bioRxiv - Bioengineering 2020Quote: ... FITC-conjugated anti-human CD4 (BD Bioscience), FITC-conjugated anti-human CCR5 (BioLegend) ...
-
bioRxiv - Microbiology 2021Quote: ... anti-human IL2 (BD Bioscience, Cat# 551383), and anti-human TNFα (BD Bioscience ...
-
bioRxiv - Cancer Biology 2020Quote: ... FITC Anti-Human HLA-A2 from BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: BV421 anti-human CD31 antibody (BD Biosciences); cat # 564089
-
bioRxiv - Biophysics 2021Quote: ... mouse anti-human CD28 antibody (BD Pharmingen), and mouse antihuman CD3 antibody (Diaclone).
-
bioRxiv - Cancer Biology 2022Quote: ... and 1% human Fc block (BD Biosciences). Immunolabeling was performed with the PELCO BioWave Pro 36500-230 microwave equipped with a PELCO SteadyTemp Pro 50062 Thermoelectric Recirculating Chiller (Ted Pella ...
-
bioRxiv - Systems Biology 2022Quote: Recombinant human EGF was purchased from BD Biosciences (San Jose ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies targeting human CD45 (BD Biosciences, 347464), CD137 (BD Biosciences ...