Labshake search
Citations for Becton, Dickinson and Company :
851 - 900 of 7401 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 1 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Bacteria were cultured on Tryptic Soy agar plates or in filter-sterilized Tryp-c Soy broth (BD Diagnostics). All cultures were incubated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were iced 30 minutes and detached trophozoites were transferred to 8 ml screw-capped tubes (BD Falcon). Once these tubes reached >50% confluency ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cells in the S phase using incubation with bromodeoxyuridine (BrdU) for 1 h and labeling with an anti-BrdU antibody (APC BrdU flow kit, BD Biosciences, San Jose, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse-α-Flotillin-1 (1:1000, clone 18/Flotillin-1; BD Biosciences), mouse-α-LC3 (1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... CA or 1: 1000 anti-OPA-1: 612607 and 1: 1000 anti-Drp-1: 611113 obtained from BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:4000 Sca-1-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:4000 Sca-1-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-LAMP-1 (1:2500; BD Biosciences), anti-Rab-7 (1:2500 ...
-
bioRxiv - Cell Biology 2019Quote: ... EEA1 (BD Biosciences, 1:100-1:200) and MPR (1:100-1:200) ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-caveolin-1 (BD Transduction, 1:500), and anti-paxillin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-PECAM-1 (1:400, BD), rabbit anti-laminin (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Flotilin-1 (1:1,000; #610820; BD Biosciences), or GM130 (1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-BP-1 (BP-1, BD Bioscience), anti-CD2 (RM2-5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-Flot-1 (1:1000, 610820, BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fibronectin 1 (1:1000; #610077; BD Biosciences), FAK (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: (1) Ly6G (1:300, 551459; BD Pharmingen)–Opal 540 ...
-
bioRxiv - Neuroscience 2023Quote: ... flotillin 1 (BD Transduction 610821, 1/1000), CD81 (Cell Signaling D3N2D ...
-
bioRxiv - Cell Biology 2023Quote: ... flotillin-1 (BD Biosciences, 610820, 1:1000), HSC70 (GeneTex ...
-
bioRxiv - Cancer Biology 2023Quote: (1) Ly6G (1:300, 551459; BD Pharmingen)–Opal 540 ...
-
bioRxiv - Immunology 2023Quote: ... PAC-1-FITC (1:10; BD Biosciences), and anti-CD62P-APC (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD31/PECAM-1 (1:300, BD), anti-ZO-1 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Microbiology 2019Quote: ... strains were streaked onto Trypticase Soy Agar II plates (TSA) containing 5% sheep blood (BD BBL, New Jersey, USA). For growth in liquid culture ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... MLO-Y4 cells were cultured as described on plastic tissue culture plates coated with rat-tail collagen I (BD). These cells are cultured in 2.5% heat-inactivated Fetal Bovine Serum (Characterized ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Cell Biology 2019Quote: ... Established iSML iPSCs were maintained in Nutristem-XF (Biological Industries) in plates coated with hESC-qualified matrigel (BD Biosciences) and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2019Quote: ... Rat hippocampal cells were plated on poly-D lysine coated 96 well imaging plates (BD Biosciences, San Jose, CA) (~16 plates per week ...
-
bioRxiv - Microbiology 2021Quote: ... Single colony was stab-inoculated with a sterile toothpick on the surface of LBNS plates (0.3% BD Bacto Agar). Plates were incubated upright at 37 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on PDL-coated 96-well microplates (7000 cells per well; black/clear imaging plate, BD Falcon 353219). RGCs were cultured in serum-free medium (Neurobasal/Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... The diluted whole lung or cell lysate were then separately plated on Middlebrook 7H10 agar plates (BD Bioscience, #295964) along with streptomycin (50μg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were incubated at 37 °C in anaerobic chambers with GasPak™ EZ Gas Generating Container System (BD Diagnostics) to maintain the anaerobic condition during the incubation for indicated time points ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 20 batches of 24 eggs each were placed in wells of 6-well plates (Falcon, BD Biosciences, Allschwil, Switzerland). Ten mL of diluted milt of 2 males each was prepared such that each male was represented with the same concentration of active sperm (25 Mio/mL ...
-
bioRxiv - Microbiology 2021Quote: ... 30 and 38 community composition was measured by plating on nutrient agar plates (5g/L peptone BD difco, BD Bioscience ...
-
bioRxiv - Immunology 2020Quote: ... CD19+ Pf+ or HA+ B cells were single cell–sorted into 96-well plates using a FACSAria II (BD). Index sorting was used to determine isotype and B cell subsets by IgM ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed with PBS prior to the addition of 100 μL/well TMB substrate (BD Biosciences). Fifteen minutes after the addition of substrate ...
-
bioRxiv - Microbiology 2022Quote: ... They were cultivated on PDA plates at 25°C for growth and in potato dextrose broth (BD Difco™) culture for genomic DNA extraction as previously reported41 ...
-
bioRxiv - Cancer Biology 2021Quote: ... isolated GSCs or GSCs expressing shHAUSP were cultured on plates or coverslips pretreated with the Matrigel (354230; BD Biosciences) and induced for differentiation in serum-containing medium (1% FBS in DME ...
-
bioRxiv - Cell Biology 2022Quote: ... The sorting into 384-well plates was performed with a 100 µm nozzle on BD FACS AriaIII CellSorter (BD BioScience Flow Cytometry System equipped with four lasers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the transwell inserts from the CIM plates were coated with 20 μl of growth-factor-reduced Matrigel (BD Biosciences), at a concentration of 250 μg/ml ...
-
bioRxiv - Systems Biology 2019Quote: ... These cells were seeded overnight at either 20,000 cells/well in 24-well plate (BD Falcon, Cat No. 353047), 40,000 cells/well in 12-well plates (Corning ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (2.5 ml) was added to the wells of 6-well plates (BD Biosciences Inc., Franklin Lakes, NJ) and allowed to solidify ...
-
bioRxiv - Cell Biology 2019Quote: Melan-a cells were trypsinized and seeded at density of 1X105 cells/well in 6 well plate (BD Bioscience) and incubated overnight with antibiotic containing RPMI 1640+10% FBS ...