Labshake search
Citations for Becton, Dickinson and Company :
851 - 900 of 8670 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV605 (BD, 563260), 2 μl of SA-BV480 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BUV395 (BD, 564176), 0.4 μl of SA-BYG670 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV650 (BD, 563855), 2 μl of SA-BV605 (BD ...
-
bioRxiv - Immunology 2021Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (Clone GK1.5 ...
-
bioRxiv - Genomics 2021Quote: ... Panel 2: CD206 (19.2, PE, 555954 BD), CD36 (SMΦ ...
-
bioRxiv - Immunology 2021Quote: ... Surface markers include: CD3 (SP34-2, BD), CD4 (L200 ...
-
bioRxiv - Immunology 2021Quote: ... CD3e (clone SP34-2, BD Biosciences, 557917), CD4 (clone L200 ...
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Immunology 2024Quote: ... CD80-BV650 (clone M18/2, BD Bioscience), MHCII-BUV661(clone M5/114 ...
-
bioRxiv - Immunology 2024Quote: ... with 2 μM Golgi Plug (BD Biosciences) added for the last 3 h of stimulation ...
-
bioRxiv - Immunology 2024Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (clone GK1.5 ...
-
bioRxiv - Microbiology 2024Quote: ... 2% CHG in 70% Isopropanol (ChloraPrep; BD) was serially diluted with 1X PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) Bacto TM peptone (BD), pH 5.5
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-flotillin-2 (BD Biosciences 610384), rabbit anti-CD9 (CST D801A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Skim Milk 2 g (BD Cat #232100), Saline solution 0.9% (Sodium chloride ...
-
bioRxiv - Bioengineering 2023Quote: ... pneumoniae serotype 3 (Sp3) (ATCC; Manassas, VA) was cultured on plates of BBL Trypticase Soy Agar with 5% sheep blood (BD Trypticase Soy Agar II) (BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell suspensions were blocked for 5 min at 4 °C with rat anti-mouse CD16/CD32 (#553142, Mouse BD Fc Block, BD Biosciences) in FACS buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 98 mL of fresh MRS medium is then inoculated with 2 mL of the overnight culture and incubated at 37°C without shaking to an OD of 0.5-0.6 (ca. 4-5 hours) in a GasPak anaerobic jar (BD GasPak™ EZ container systems). Cells are harvested a first time by centrifugation at 4,000 g for 5 min ...
-
bioRxiv - Systems Biology 2022Quote: ... coli strain JM109 (1 × 1010 colony-forming units (CFU)/ml) were cultured for various times in 2 ml of 2xYT liquid medium (BD Difco, Cat# 244020) containing various concentrations of pyridoxal 5’ -phosphate (pH adjusted to 7.0) ...
-
bioRxiv - Immunology 2022Quote: ... blood cells were stained in 50 µl 2% FCS RPMI medium with antibodies against CD11C (APC, clone HC3, BD biosciences, dilution 1/100), CD11b (PercPCy5.5 or Pacific Blue ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 hour and then exposed overnight at 4°C to the primary antibody (ZO-1, 610966, BD transduction). Following three washes in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... We then create a 1 mm thick sheet of agarose using a 3 mL syringe (BD, 3 mL Luer lock) and a blunt needle (Industrial Dispensing Supplies ...
-
bioRxiv - Pathology 2024Quote: ... and then incubated overnight at 4 °C with primary antibodies directed against amino acids 15–123 of the α-Synuclein protein (1:1,000 dilution, ref: 610786, BD Biosciences) diluted in the blocking buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Cancer Biology 2021Quote: ... and BV421 mouse anti-human CD366 (TIM-3) (1:100; 565562, BD Biosciences).
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were incubated overnight in 1:3 diluted cytofix in PBS (BD 554655) at 4 degrees Celsius with agitation ...
-
bioRxiv - Bioengineering 2021Quote: ... Sections were incubated with rabbit anti-active caspase-3 (1:40, BD, 559565) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Caspase-3 monoclonal antibody (1:500, clone C92-605; BD Biosciences), Click-iT Tunel Alexa Fluor 647 (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... Panel #3 included anti-human CD8 BUV396 (RPA-T8, BD Biosciences, 1:20), CD20 BUV737 (L27 ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Immunology 2022Quote: Synovial tissue was fixed in 1:4 dilution Fixation/Permeabilization solution (BD Biosciences Cytofix/Cytoperm Cat No ...
-
bioRxiv - Neuroscience 2020Quote: ... fixed with 4% paraformaldehyde and stained (Syn1 antibody, BD Biosciences, 1:500) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Fluo-4 AM was from Thermo and Indo-1 AM from BD.
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...