Labshake search
Citations for Becton, Dickinson and Company :
801 - 850 of 7656 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Panel 2: CD206 (19.2, PE, 555954 BD), CD36 (SMΦ ...
-
bioRxiv - Immunology 2021Quote: ... Surface markers include: CD3 (SP34-2, BD), CD4 (L200 ...
-
bioRxiv - Immunology 2021Quote: ... CD3e (clone SP34-2, BD Biosciences, 557917), CD4 (clone L200 ...
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Immunology 2024Quote: ... CD80-BV650 (clone M18/2, BD Bioscience), MHCII-BUV661(clone M5/114 ...
-
bioRxiv - Immunology 2024Quote: ... with 2 μM Golgi Plug (BD Biosciences) added for the last 3 h of stimulation ...
-
bioRxiv - Immunology 2024Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (clone GK1.5 ...
-
bioRxiv - Microbiology 2024Quote: ... 2% CHG in 70% Isopropanol (ChloraPrep; BD) was serially diluted with 1X PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) Bacto TM peptone (BD), pH 5.5
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-flotillin-2 (BD Biosciences 610384), rabbit anti-CD9 (CST D801A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Skim Milk 2 g (BD Cat #232100), Saline solution 0.9% (Sodium chloride ...
-
bioRxiv - Cell Biology 2020Quote: ... Percentage of platelets in BALF (n=3-6) was quantified on a BD FACSVerse flow cytometer (BD Biosciences, San Jose, USA) and analysed with FlowJo v10 software (FlowJo LLC ...
-
bioRxiv - Microbiology 2021Quote: ... nasopharyngeal (NP) swabs were collected N using the BD Universal Viral Transport Media system (Becton, Dickinson and Company, Franklin Lakes, NJ) from symptomatic patients ...
-
bioRxiv - Immunology 2021Quote: ... the wells were washed six times with DPBS containing 0.05% (v/v) Tween-20 (PBS-T 0.05%) and blocked with 3% (w/v) Difco Skim Milk (cat. n° 232100, BD Biosciences, USA) in PBS-T 0.05% for 2 h in agitation at RT ...
-
bioRxiv - Microbiology 2020Quote: ... from the four subgroups were co-cultured in the Biolog AN Microplate in a pairwise fashion (n =6, AB, AC, AD, BC, BD, CD), by combining 50 μL of each isolate suspended in inoculation fluid in each well ...
-
bioRxiv - Immunology 2023Quote: ... and the 2D effective affinity AcKa was estimated by normalizing <n> against mr and ml that were measured using PE-labeled monoclonal antibody together with QuantiBRITE PE standard beads (BD Biosciences):
-
bioRxiv - Bioengineering 2023Quote: ... 5 µg of LPP formulated circRNA or linear RNA encoding Firefly Luciferase (FLuc) in PBS were administrated into mice (n=3 for each group) intramuscularly with 3/10 insulin syringes (BD biosciences). Mice were then anesthetized for whole-body bioluminescence imaging with an IVIS Spectrum (Roper Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... coli strain JM109 (1 × 1010 colony-forming units (CFU)/ml) were cultured for various times in 2 ml of 2xYT liquid medium (BD Difco, Cat# 244020) containing various concentrations of pyridoxal 5’ -phosphate (pH adjusted to 7.0) ...
-
bioRxiv - Immunology 2022Quote: ... blood cells were stained in 50 µl 2% FCS RPMI medium with antibodies against CD11C (APC, clone HC3, BD biosciences, dilution 1/100), CD11b (PercPCy5.5 or Pacific Blue ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Immunology 2022Quote: ... anti-CD4-BV605 (BD Biosciences 563151: Clone: RM4-5), and anti-CD8a Super Bright 702 (Invitrogen 67-0081-82 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD2 PE (clone RM2-5, BD Pharmingen, RRID: AB_2073810), CD5 PE (clone 53-7.3 ...