Labshake search
Citations for Becton, Dickinson and Company :
801 - 850 of 7372 citations for Cortisone ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Cells from ELISpot plate were collected in media supplemented with GolgiStop Protein Transport Inhibitor (BD Biosciences, NJ, USA) and incubated for 6 hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... the population was single-cell FACS-sorted into 96-well plates containing RPMI11+2S (BD FACSMelody Cell Sorter). After 1.5-2 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... assay plates were prepared the day of the assay by adding 10 mL of 2% Difco-agar (BD) in assay buffer (5 mM potassium phosphate ...
-
bioRxiv - Immunology 2023Quote: ... Cells were plated in 96-well plates coated with anti-CD3 antibody (5μg/ml, BD, clone 145-2C11) at a density of 3 x 106 cells/ml ...
-
bioRxiv - Microbiology 2023Quote: ... and Columbia blood agar plates supplemented with 5% sheep’s blood (CB) (Becton, Dickinson and Company, Sparks, MD, USA). Similarly ...
-
bioRxiv - Immunology 2023Quote: ... plates were coated with 50 μl of 2 μg/ml anti-mouse IgE (clone R35-72M; 553413, BD) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... We sorted tdTomato-positive/DAPI- negative cells into 4 96-well plates using an ARIA Sorter III (BD) and BD FACSDiva software 8.0.1.
-
bioRxiv - Molecular Biology 2023Quote: ... Liquid nitrogen stocks of PC12 cells were plated on Falcon flat-bottomed 96-well plates) (#353219; BD Falcon), each well containing ∼3.0 104 cells in 100 µl growth media ...
-
bioRxiv - Biochemistry 2023Quote: ... nanobodies were purified with a 96-wells HIS-TRAP plate or a Cobalt-NTA (Talon) column (BD Biosciences), eluting with a buffer containing 25 mM HEPES (pH 7.8) ...
-
bioRxiv - Cancer Biology 2023Quote: ... single cells were deposited in 96 well plates using a BD FACSAria III (BD Biosciences, Franklin Lakes, NJ). Outgrowing clones were condensed to a 96 well plate in duplicate to propagate clones and generate a genomic DNA source ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed again with PBS+Tween-20 0.05% followed by the addition of TMB substrate (BD, 555214). Plates were allowed to develop for 10-25 minutes before adding 1M H2SO4 stop solution ...
-
bioRxiv - Cell Biology 2023Quote: ... single cells were deposited in 96-well plates by flow sorting with a FACS Aria III (BD Biosciences). Single clones were expanded and DNAs were prepared from 81 clones ...
-
bioRxiv - Immunology 2023Quote: ... and positive control cells were incubated in plates coated with anti-CD3 (1μg/ml) (clone HIT3a, BD Biosciences). Results were expressed as cell division index which is the ratio of %CFSElow splenocytes (proliferating splenocytes ...
-
bioRxiv - Cell Biology 2023Quote: 50,000 cells per well were seeded in a 24-well plate (Corning Inc. BD Falcon, Corning, NY, USA) and incubated for 48h ...
-
bioRxiv - Cancer Biology 2023Quote: ... At 48h ATTO550+ve single cells were FACS sorted into 96-well plates (BD FACSAria Fusion cell sorter) and ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria were cultured on Tryptic Soy agar plates or in filter-sterilized Tryp-c Soy broth (BD Diagnostics). All cultures were incubated at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... Naïve T cells were activated with plate bound anti-CD3ε (5 µg/ml, clone: 145-2C11, BD Biosciences) and soluble anti-CD28 (0.5 µg/ml ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 48h cultures were diluted and plated on Nutrient Agar plates (5 g/L peptone BD difco, BD Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were iced 30 minutes and detached trophozoites were transferred to 8 ml screw-capped tubes (BD Falcon). Once these tubes reached >50% confluency ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells expressing HaloTag were subjected to single-cell sorting into 96-well plates (FACSAria Fusion, BD Biosciences).
-
bioRxiv - Cancer Biology 2019Quote: ... and cells in the S phase using incubation with bromodeoxyuridine (BrdU) for 1 h and labeling with an anti-BrdU antibody (APC BrdU flow kit, BD Biosciences, San Jose, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse-α-Flotillin-1 (1:1000, clone 18/Flotillin-1; BD Biosciences), mouse-α-LC3 (1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... CA or 1: 1000 anti-OPA-1: 612607 and 1: 1000 anti-Drp-1: 611113 obtained from BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:4000 Sca-1-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:4000 Sca-1-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-LAMP-1 (1:2500; BD Biosciences), anti-Rab-7 (1:2500 ...
-
bioRxiv - Cell Biology 2019Quote: ... EEA1 (BD Biosciences, 1:100-1:200) and MPR (1:100-1:200) ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-caveolin-1 (BD Transduction, 1:500), and anti-paxillin (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-PECAM-1 (1:400, BD), rabbit anti-laminin (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Flotilin-1 (1:1,000; #610820; BD Biosciences), or GM130 (1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-BP-1 (BP-1, BD Bioscience), anti-CD2 (RM2-5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-Flot-1 (1:1000, 610820, BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fibronectin 1 (1:1000; #610077; BD Biosciences), FAK (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: (1) Ly6G (1:300, 551459; BD Pharmingen)–Opal 540 ...
-
bioRxiv - Neuroscience 2023Quote: ... flotillin 1 (BD Transduction 610821, 1/1000), CD81 (Cell Signaling D3N2D ...
-
bioRxiv - Cell Biology 2023Quote: ... flotillin-1 (BD Biosciences, 610820, 1:1000), HSC70 (GeneTex ...
-
bioRxiv - Cancer Biology 2023Quote: (1) Ly6G (1:300, 551459; BD Pharmingen)–Opal 540 ...
-
bioRxiv - Immunology 2023Quote: ... PAC-1-FITC (1:10; BD Biosciences), and anti-CD62P-APC (1:100 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD31/PECAM-1 (1:300, BD), anti-ZO-1 (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Microbiology 2019Quote: ... strains were streaked onto Trypticase Soy Agar II plates (TSA) containing 5% sheep blood (BD BBL, New Jersey, USA). For growth in liquid culture ...
-
bioRxiv - Immunology 2021Quote: ... BMDMs or iBMDMs were routinely plated at 4×105 cells/well in 24-well tissue culture plates (BD Falcon) or 1×105 cells/well in 96-well flat bottom tissue culture plates ...
-
bioRxiv - Genomics 2020Quote: ... 100μl cell suspension medium was seeded in each well of 96 well plates (BD Biosciences, Franklin Lakes, NJ, USA) and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Physiology 2022Quote: Primary mouse hepatocytes were cultured in BD BioCoat™Collagen 6-well plates (BD Pharmingen, Franklin Lakes, NJ, USA) at 1-1.5 x 106 cells per well in William’s medium (catalog n°12551032 ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Molecular Biology 2019Quote: ... MLO-Y4 cells were cultured as described on plastic tissue culture plates coated with rat-tail collagen I (BD). These cells are cultured in 2.5% heat-inactivated Fetal Bovine Serum (Characterized ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...