Labshake search
Citations for Becton, Dickinson and Company :
801 - 850 of 7309 citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... and incubated overnight with a cocktail of intracellular antibodies – IL-6 (BD Biosciences, MQ2-6A3, FITC), TNFα (BD Biosciences ...
-
bioRxiv - Cell Biology 2019Quote: ... The following day they were probed with antibodies to FLAP (Novus, IMG 3160, 1:100) and to 5-LO (BD Biosciences, 610695, RRID: AB_398018). Secondary antibodies were applied at 3 µg/mL for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... filters were blocked in 5% BSA and probed overnight at 4°C with the following primary antibodies and dilutions: p16 (1:200, #554079 BD Biosciences, San Jose, CA), p53 (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... 1.5 µg/mL) [31] in the presence of anti-CD28 and anti-CD49d antibodies (both at 1 μg/ml, BD, Franklin Lakes, New Jersey) and brefeldin-A (10 μg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... for 30 min (RT) and incubated overnight (4 °C) with mouse anti-5-LOX (1:1000; # 610695; Lot: 9067817; BD Biosciences, Franklin Lakes, NJ) and rabbit anti-perilipin-2 (1:100 ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell pellet was resuspended in 1 mL sterile PBS/5% FBS and transferred to a 5 mL flow cytometry tube via a 40 µm strainer cap (BD Falcon). Viability of the final samples was between 30-35% by trypan blue exclusion ...
-
bioRxiv - Genetics 2021Quote: ... ∼3 x 105 MATα spores were sorted by FACS (BD FACSAria II) based on the absence of RFP fluorescence signal measured using a 561 nm laser and 582/15 optical filter ...
-
bioRxiv - Developmental Biology 2022Quote: ... A purified primary rabbit anti-active caspase-3 antibody (BD Biosciences, 559565) was diluted 1:500 in blocking solution and embryos were incubated overnight at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... HRP activity was further revealed using 3-amino-9-ethylcarbazole (BD Biosciences) for 8 min at room temperature in the dark ...
-
bioRxiv - Genomics 2019Quote: ... A custom-made syringe catheter (consisted of 3-ml syringe (BD #309657), Luer lock 26-gauge 1/2” dispensing needle (GraingerChoice #5FVG9) ...
-
Targeting MOG to skin macrophages prevents EAE in macaques through TGFβ-induced peripheral tolerancebioRxiv - Immunology 2019Quote: ... Cells were analyzed on a 3-laser LSR II flow cytometer (BD) with at least 105events collected ...
-
bioRxiv - Cancer Biology 2019Quote: ... and then washed 3 times with FACs buffer (BD Biosciences, Billerica, MA).
-
bioRxiv - Immunology 2022Quote: ... we added 3 μL of anti-CD123-APC (clone 7G3, BD Bioscience), 4 μL of anti-CD45-PE (clone HI30 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mouse anti-human LAG-3 conjugated to BV421 (BD Biosciences, 565721). Antibodies used for mouse cells are rat anti-mouse CD8a conjugated to FITC (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... Cleaved caspase-3 (Essen Bioscience, 4704) and CD45 (BD Pharmingen™, 553076) staining was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then stained with anti-cleaved caspase 3-PE (BD #550821) and anti-GATA1 (Abcam ab181544 ...
-
bioRxiv - Microbiology 2021Quote: ... The 3-amino-9-ethycabazole (AEC) substrate kit was purchased from BD Pharmingen.
-
bioRxiv - Immunology 2020Quote: ... Cells were exposed to anti-CD40 (1ug/ml, BD Clone HM40-3) and rIL-4 (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... Flow cytometry cell sorting was performed on an ARIA 3 (BD Biosciences) apparatus on single-cell suspensions from spleens or Peyer’s patches ...
-
bioRxiv - Cancer Biology 2022Quote: ... human PBMCs (3×105 cells/condition) were incubated with CD8 (BD, 562428), CD25 (BD ...
-
bioRxiv - Immunology 2022Quote: ... perflava was cultured on Gonococcal medium base (GCB, BD #DF0289-17-3) plus Kellogg’s supplements [63] at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... was prepared and loaded into a 3 mL syringe (BD Biosciences, #309657). Primer-conjugated agarose was completely melted at 95°C for over 2 hours and subsequently loaded into a 3 mL syringe ...
-
bioRxiv - Immunology 2024Quote: ... GATA-3 (TWAJ, eF660, eBioscience, or L50-829, PE-Cy7, BD Biosciences), T-bet (4B10 ...
-
bioRxiv - Microbiology 2024Quote: ... single colonies were inoculated into 3 ml Tryptic Soy Broth (TSB, BD) with 10 µg/ml chloramphenicol (Cm10 ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed using FCAP Array software v.3 (BD Biosciences).
-
bioRxiv - Cell Biology 2024Quote: ... then sort-matched for GFP using a FACSMelody 3-laser sorter (BD).
-
bioRxiv - Genetics 2022Quote: ... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were stained with an activated caspase-3 antibody (BD Biosciences, anti:Rabbit) to mark apoptotic cells ...
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Biophysics 2024Quote: ... sealed at the other end by a 0.6x30mm needle (BD, microlance 3) attached to a 3mL syringe (Braun ...
-
bioRxiv - Cell Biology 2019Quote: NHEM cells were trypsinized and seeded at density of 1X105cells/well in 6-well plate (BD Bioscience) and incubated overnight with antibiotic containing M254 (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... Concentrations of IL-6 and IL-10 were interpolated using FCAP Array software (v. 3.1, BD Biosciences) from standard curves ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Developmental Biology 2021Quote: ... non-adherent bone marrow cells were seeded in triplicate in 6-well collagen-coated plates (BD Biosciences) at a density of 1×105 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... P was analyzed (as molybdate reactive P) in the 6 extracts (referred to as H2O-P, BD-P ...
-
bioRxiv - Immunology 2020Quote: ... then stained with the antibodies described in Supplementary Table 6 and analysed on the LSRII (BD Bioscience). Data were analysed with the FlowJo v10.4.2 software (FlowJo LLC).
-
bioRxiv - Microbiology 2020Quote: ... and IFN-γ secreted by splenocytes of C57BL/6 mice were determined using ELISPOT kits (BD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Stained cells were analyzed using a BD LSRII Fortessa equipped with FACSDiva software (Version 6) (BD Pharmingen). Samples were acquired using Fortessa’s HTS plate reader option at an event rate below 20,000 events/s ...
-
bioRxiv - Microbiology 2023Quote: ... a final concentration of 10 μg/ml Brefeldin A and 6 μg/ml Golgi-Stop (BD Biosciences) were added ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2024Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...