Labshake search
Citations for Becton, Dickinson and Company :
751 - 800 of 909 citations for Dengue Virus Serotype 3 DIII envelope protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Between 2 - 4×105 events were collected per sample within 3 hours after staining on a LSRFortessa (BD Biosciences, 4 lasers, 18 parameters) and analyzed using FlowJo software (version 9.7.4 ...
-
bioRxiv - Cell Biology 2021Quote: ... by subcutaneous injection of 3 × 105 A375 or H2122 cells in RPMI-1640 medium supplemented with 50% Matrigel (BD Biosciences, cat. no. 354234). Seven days after the injection ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples were immediately split into 3 fractions: 2 ml were transferred to heparin and EDTA tubes respectively (both BD, Franklin Lakes, New Jersey). Heparin samples were then centrifuged (1000x g ...
-
bioRxiv - Genetics 2020Quote: ... Timepoints were measured every 2-3 days by flow cytometry analysis of >7,000 cells (either a BD Accuri C6 or Beckman Coulter CytoFLEX). Data was analyzed using Cytoflow (https://github.com/bpteague/cytoflow ...
-
bioRxiv - Immunology 2020Quote: Female C57BL/6J mice aged 8 – 12 weeks were injected intraperitoneally with 2 ml each of 3% sterile thioglycollate (BD Biosciences, catalog # 211716) medium ...
-
bioRxiv - Immunology 2021Quote: ... were resuspended in defRPMI-1640 with 3% newborn calf serum and Benzonase™ (FACS buffer) in 5 mL FACS tubes and pre-incubated with GolgiStop™ (BD Biosciences) for ∼60 min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Mice were inoculated subcutaneously (50uL) with 3×104 PFU or injected intracranially (10uL) with 50 PFU of LGTV-TP21 using insulin syringes (BD Medical, #BD-329461). At appropriate times post infection ...
-
bioRxiv - Pathology 2023Quote: ... The culture medium was sampled by adding 1-3 drops to microscope slides followed by Gram stain (BD BBLTM Gram Stain Kits; B12539) and imaging.
-
bioRxiv - Cancer Biology 2022Quote: ... were plated around the rim of the well of a 96-well plate in a 4:3 mixture of Matrigel and MammoCult medium (BD Bioscience CB-40324). The cell mixture was then incubated at 37°C with 5% CO2 for 15 min to solidify the gel ...
-
bioRxiv - Systems Biology 2022Quote: Single cell suspensions were plated around the rim of the well in the 3:4 mixture of Mammocult and Matrigel (BD Bioscience CB-40324). We seed 5’000 cells/wells for mini-rings in white 96-well plates (Corning #3603 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following overnight incubation the plate was washed 3 times with DPBS and then incubated with 20 µl anti-CD45 antibody (BD Pharmingen, catalog #550539) in 12 ml of 0.2% BSA for a minimum of 2 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... of both preparations was determined by titration onto target cell lines and quantification of the percentage of BFP+ cells 2–3 days post-transduction by flow cytometry (BD Biosciences LSR II).
-
bioRxiv - Microbiology 2023Quote: ... and allowed to gel over a 1-mL layer of acellular collagen in six-well culture inserts with 3-μm-pore polycarbonate filters (BD Biosciences NJ, USA). Gels were allowed to contract for 4–5 days before seeding with 3×105 HaCaT keratinocytes in serum and mitogen-supplemented DMEM/F12 raft medium ...
-
bioRxiv - Immunology 2024Quote: ... n=3 samples per genotype) for FACS enrichment of islet immune cells via BD FACS ARIA II (BD Biosciences, San Jose, CA, USA) into PBS containing 2% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... All experiments were performed with n ≥ 3 from independent overnight cultures starting from single colonies on LB agar plates (BD; Franklin Lakes, NJ).
-
bioRxiv - Physiology 2021Quote: ... Sections were then washed with PBS 3 times for 15 min and incubated with PBS containing Hoechst (1:5000, #561908, BD Pharmingen, Lincoln Park, NJ) for 5 min before a final series of washes with PBS.
-
bioRxiv - Microbiology 2022Quote: ... oxysporum conidia were isolated after growth for 3-4 d in potato dextrose broth (PDB; Becton, Dickinson and Company, Le Pont de Claix, France) by filtering through two layers of Miracloth® (Merck Millipore ...
-
bioRxiv - Bioengineering 2023Quote: ... so that the microfluidic tubing (Scientific Commodities,Inc., BB31695-PE/3) can connect the device to the sample sources in a syringe (BD 1 mL, NJ, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... The phosphorylation-SMAD2/3 ability of CAR T cells was detected using PE Mouse anti-Smad2/Smad3 antibodies (clone O72-670, BD Biosciences, Franklin Lakes, NJ) following the staining protocols ...
-
bioRxiv - Immunology 2022Quote: ... and F15 NOD Nfκb1 heterozygote were suspended in biotin-free RPMI containing 0.1% azide and 3% FCS and surface stained in 96-well plates with the 10–3.6 PE (anti-I-Ag7) (BD PharMingen, Franklin Lakes, NJ, USA), which is class II major histocompatibility complex (MHC ...
-
Angiogenesis in the mature mouse cortex is governed in a region specific and Notch1 dependent mannerbioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight in 0.1M PBS + 0.1% TX-100 solution containing primary antibody for rat anti-CD31 (label endothelial cells; 1:200 dilution, BD Clone MEC 13:3: #553370) or sheep anti-CD93 (label endothelial tip cells ...
-
bioRxiv - Pathology 2024Quote: ... phosphorylated TDP-43 (clone 11-9, 1:2000, CosmoBio, Tokyo, Japan) and anti-p62 (3/P62 LCK LIGAND, 1:500 BD Company, NJ, United States) were employed ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... analysis of sub-G0/G1 DNA content as previously described (23) and by measurement of active caspase-3 by flow cytometry using a commercial kit (BD Biosciences, Franklin Lakes, NJ).
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were transferred to supported nitrocellulose membrane and probed using Syn101 antibodies against aSyn (BD labs, San Jose, CA). Blots were imaged on using a ChemiDoc MP imager and analyzed using Image Lab (Bio-Rad ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... cells expressing TagRFP-tagged proteins were flow-sorted using a BD Influx cell sorter (BD Bioscience, San Jose, CA). TagRFP emission was triggered by 561 nm laser ...
-
bioRxiv - Cell Biology 2022Quote: ... Immunoprecipitation experiments were performed by incubating 100 μg of protein with 2.5 μg of anti-RIPK1 (BD Transduction Laboratories) with rotation at 4 °C for 48 h ...
-
bioRxiv - Immunology 2022Quote: ... and the levels of protein surface expression were analyzed by flow cytometry using a FACS Canto II (BD Biosciences). The data obtained by flow cytometry were analyzed with FlowJo software (Tree Star).
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2021Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Immunology 2020Quote: ... peridinin chlorophyll protein complex cyanine (PerCP-Cy™5.5) mouse anti-human CD163 (BD Biosciences; San Jose, CA, USA) and allophycocyanin (APC ...
-
bioRxiv - Developmental Biology 2020Quote: ... Prox1 and pErkT202/Y204 proteins were detected non-fluorescently using biotinylated goat anti-rabbit IgG (1: 400, BD Biosciences) followed by avidin-HRP and DAB detection (Vector labs ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Surface or total MPL proteins were stained with anti- human MPL-PE antibody (BD Pharmingen 562159; 1:50 dilution).
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Immunology 2022Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Molecular Biology 2024Quote: ... We stained intracellular proteins using the following antibodies: anti-mouse CD3 BUV737 (1:100, 17A2, BD Biosciences, Cat. 612803) and anti-mouse CD4 Alexa Fluor 700 (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... We processed the membrane for protein detection using antibodies against CD63 (1:1000; BD Biosciences, San Jose, California, USA), CD81 (1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Neuroscience 2024Quote: ... in flotation for 1 h at room temperature and then overnight at 4°C with the mouse antibody that recognizes protein GM130 (Cat# A-610822, RRID:AB_398141, BD Biosciences), followed by incubation for 2 h at room temperature with Alexa Fluor 546-conjugated goat anti-mouse secondary antibodies (Cat#A-11030 ...
-
bioRxiv - Genomics 2020Quote: ... each anaesthetised snail was injected with 170 μL of snail saline (see Standen 1975) in the head-foot using a syringe and needle (0.45 mm × 16 mm BD Microlane™ 3, New Jersey, USA). This treatment examined the effect of wounding in activating immune defence when compared to anaesthesia without exposure to immune elicitors (treatment 2 above) ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... Reactions were fixed with 40 µL of 1% glutaraldehyde/BD buffer for 3 min and diluted with 800 µL BRB80 (BD buffer without 1 mM DTT). Fixed and diluted samples were added to spin down tubes containing a removable chock ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... NP-FB23-2 (3 mg/kg) was delivered through the retro-orbital sinus into neonatal mice with a 31-gauge insulin syringe (BD Biosciences, San Jose, CA, USA).
-
bioRxiv - Pathology 2024Quote: ... Sections were incubated with a goat monoclonal antibody against EEA1 (1/100; SICGEN, Cantanhede, Portugal) and Caveolin 3 (1/750, BD Biosciences, Pont de Claix, France) antibodies (for dog sections ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Bioengineering 2020Quote: ... we preincubated 2 µmol recombinant B56 protein with 1 µmol mouse anti-B56 antibody (Clone 23/B56α BD biosciences, 610615) and 1 µmol goat anti-mouse IgG Alexa Fluor 647 (Thermo Fisher A-21235 ...