Labshake search
Citations for Becton, Dickinson and Company :
751 - 800 of 3554 citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2% bactopeptone (BD Biosciences, Franklin Lakes, USA), 1% D-glucose (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and IL-2 (clone JES6-5H4; BD), and staining was performed in the presence of unlabeled anti-CD16/CD32 antibody (clone 2.4G2 ...
-
bioRxiv - Cell Biology 2022Quote: ... Flotillin-2 (1:1000, BD Biosciences, 610383), Caveolin-3 (1:4000 ...
-
bioRxiv - Genetics 2021Quote: ... and 2% dextrose (BD P/N 15530). Cultures were grown to stationary phase (two days at 30°C) ...
-
bioRxiv - Immunology 2022Quote: ... and Golgiplug (2 µg/ml; BD Biosciences) for 4 h and the FOXP3 / Transcription Factor staining buffer set (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 ng/ml IL-2 (BD Pharmingen), and 2.5 ng/ml TGF-β (R&D system ...
-
bioRxiv - Immunology 2020Quote: ... IgD (clone IA6-2, BD, BV480, 566138) and CD19 (clone HIB19 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% (w/v) Bacto peptone (BD Biosciences), and 2% (w/v ...
-
bioRxiv - Immunology 2021Quote: ... CD3 APC-Cy7 (clone SP34-2, BD Biosciences Cat# 557757 ...
-
bioRxiv - Immunology 2021Quote: ... CD3 Cy7APC (clone SP34-2, BD Pharmingen). Biotinylated prefusion-stabilized spike (S-2P ...
-
bioRxiv - Immunology 2020Quote: ... from Biolegend and CD138-APC (281-2) from BD Biosciences.
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μg/ml Laminin (BD Bioscience) in DMEM/F12 medium supplemented with 1X B27 ...
-
bioRxiv - Immunology 2021Quote: ... and 2 μg/ml anti-CD28 (BD) in the presence of 20 ng/ml IL-6 (PeproTech) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v galactose (BD Biosciences 216310)) at an OD600 of 0.3 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), and 2% w/v raffinose (Becton Dickinson 217410)) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2% w/v Bacto-peptone (BD Biosciences), 2% w/v galactose (BD Biosciences 216310) ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV421 (BD, 563259), 1 μl of SA-BUV615 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV480 (BD, 564876), 2 μl of SA-BV421 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV605 (BD, 563260), 2 μl of SA-BV480 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BUV395 (BD, 564176), 0.4 μl of SA-BYG670 (BD ...
-
bioRxiv - Immunology 2020Quote: ... 2 μl of SA-BV650 (BD, 563855), 2 μl of SA-BV605 (BD ...
-
bioRxiv - Immunology 2021Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (Clone GK1.5 ...
-
bioRxiv - Genomics 2021Quote: ... Panel 2: CD206 (19.2, PE, 555954 BD), CD36 (SMΦ ...
-
bioRxiv - Immunology 2021Quote: ... Surface markers include: CD3 (SP34-2, BD), CD4 (L200 ...
-
bioRxiv - Immunology 2021Quote: ... CD3e (clone SP34-2, BD Biosciences, 557917), CD4 (clone L200 ...
-
bioRxiv - Cell Biology 2021Quote: ... flotillin 1 and flotillin 2 (BD Biosciences), E-cadherin (used for MCF10A cells ...
-
bioRxiv - Cell Biology 2021Quote: ... coated with ICAM-2 (BD Biosciences Pharmingen) for the first selection ...
-
bioRxiv - Microbiology 2020Quote: ... 2 g/L Casamino Acids (BD Biosciences), and 5 g/L glycerol (Scharlab)) ...
-
bioRxiv - Physiology 2023Quote: ... 2 μl of CD3 antibody (BD Pharmingen), 5 μl of CD4 antibody (BD Pharmingen ...
-
bioRxiv - Molecular Biology 2023Quote: ... bacto-agar (2% w/v; BD, 214010) and dextrose (2% w/v ...
-
bioRxiv - Immunology 2023Quote: ... and CD138 (Clone 281-2, BD Biosciences) for 20 min on ice ...
-
bioRxiv - Immunology 2023Quote: ... IgD-FITC (BD Biosciences, clone IA6-2) to allow for identification of memory B cells ...
-
bioRxiv - Immunology 2024Quote: ... IgD-FITC (BD Biosciences, clone IA6-2). A baiting approach was used to isolate the spike-specific B cells ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 ml of Stain Buffer (BD Biosciences) was added ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD95 (clone Jo-2; BD Biosciences), anti-CD138 (clone 281-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... ICAM-2+ and CD31+ endothelial cells (BD FACS Aria™ III Cell Sorter ...
-
bioRxiv - Biochemistry 2022Quote: ... Flotillin-2 (1:1000, BD Biosciences, 610383), Caveolin-3 (1:4000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Thrombospondin (TSP)-2 (1:100, BD Biosciences), Hevin (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... IL-2 BB700 (1:25, BD, 566405), IFNγ (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Flotillin-2 (610383, BD Biosciences), mouse anti-GAPDH (5G4cc ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% Bacto peptone (Becton, Dickinson and Company), and 2% D-glucose.
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-flotillin-2 (1:1000, BD Transduction Laboratories 610383 ...
-
bioRxiv - Immunology 2024Quote: ... CD80-BV650 (clone M18/2, BD Bioscience), MHCII-BUV661(clone M5/114 ...
-
bioRxiv - Immunology 2024Quote: ... with 2 μM Golgi Plug (BD Biosciences) added for the last 3 h of stimulation ...
-
bioRxiv - Immunology 2024Quote: ... 8.2 BUV395 (clone, MR5-2, BD Biosciences) CD4 BUV395 (clone GK1.5 ...
-
bioRxiv - Microbiology 2024Quote: ... 2% CHG in 70% Isopropanol (ChloraPrep; BD) was serially diluted with 1X PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) Bacto TM peptone (BD), pH 5.5
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-flotillin-2 (BD Biosciences 610384), rabbit anti-CD9 (CST D801A) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Skim Milk 2 g (BD Cat #232100), Saline solution 0.9% (Sodium chloride ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...