Labshake search
Citations for Becton, Dickinson and Company :
751 - 800 of 2590 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Flow cytometry was performed on a FACS analyser (Fortessa X-20, BD). For spleens ...
-
bioRxiv - Pathology 2024Quote: ... and analyzed using an LSR Fortessa X-20 flow cytometer (BD Biosciences). Mean fluorescence intensity (MFI ...
-
bioRxiv - Immunology 2024Quote: ... anti-human CD3 (AF700, clone: SP34-2, BD, cat# 557917, 1:20), anti-human PD-1 (BV650 ...
-
bioRxiv - Immunology 2024Quote: ... anti-human PD-1 (BV650, clone: EH12.1, BD, cat# 564104, 1:20), anti-human CD20 (PE/Dazzle 594 ...
-
bioRxiv - Bioengineering 2024Quote: Panel #2 included anti-human CD16 BUV396 (3G8, BD Biosciences, 1:20), CD123 BV421 (6H6 ...
-
bioRxiv - Cell Biology 2024Quote: ... and analysed by flow cytometry (BD LSRFortessa X-20 Cell Analyzer, BD Biosciences or Attune Nxt ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were acquired on the Fortessa X-20 flow cytometer (BD Biosciences). Data were analysed with FlowJo v10.8.0 ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell pellet was resuspended in 1 mL sterile PBS/5% FBS and transferred to a 5 mL flow cytometry tube via a 40 µm strainer cap (BD Falcon). Viability of the final samples was between 30-35% by trypan blue exclusion ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated on ice for 5 min with rat anti-CD16/CD32 antibody (BD Biosciences, clone 2.4G2, 5 µg/ml) and Fixable Viability Dye eFluor 660 or UV455 (eBioscience ...
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized using Phosphoflow Fix Buffer 1 and Perm Buffer 3 (BD Biosciences) and stained with antibodies raised against phosphorylated mTOR (Ser2448 ...
-
bioRxiv - Genetics 2021Quote: ... ∼3 x 105 MATα spores were sorted by FACS (BD FACSAria II) based on the absence of RFP fluorescence signal measured using a 561 nm laser and 582/15 optical filter ...
-
bioRxiv - Physiology 2022Quote: ... 1:500 for Purified mouse anti-Smad2/3 (610843, BD Biosciences, USA), 1:1000 for Phospho-AKT (Ser473 ...
-
bioRxiv - Developmental Biology 2022Quote: ... A purified primary rabbit anti-active caspase-3 antibody (BD Biosciences, 559565) was diluted 1:500 in blocking solution and embryos were incubated overnight at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... HRP activity was further revealed using 3-amino-9-ethylcarbazole (BD Biosciences) for 8 min at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse lung cryosections were stained overnight with anti-BrdU (1:3, BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... transwells were pre-coated with Matrigel (1:3 in DMEM, BD Biosciences), assays were performed with 1.5 × 104 cells plus 0.5 μg/μl mitomycin C for 72 h using 10 μg/ml collagen and 20% FBS as chemo-attractants ...
-
bioRxiv - Immunology 2022Quote: ... we added 3 μL of anti-CD123-APC (clone 7G3, BD Bioscience), 4 μL of anti-CD45-PE (clone HI30 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mouse anti-human LAG-3 conjugated to BV421 (BD Biosciences, 565721). Antibodies used for mouse cells are rat anti-mouse CD8a conjugated to FITC (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... Cleaved caspase-3 (Essen Bioscience, 4704) and CD45 (BD Pharmingen™, 553076) staining was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then stained with anti-cleaved caspase 3-PE (BD #550821) and anti-GATA1 (Abcam ab181544 ...
-
bioRxiv - Microbiology 2021Quote: ... The 3-amino-9-ethycabazole (AEC) substrate kit was purchased from BD Pharmingen.
-
bioRxiv - Immunology 2020Quote: ... Cells were exposed to anti-CD40 (1ug/ml, BD Clone HM40-3) and rIL-4 (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... Flow cytometry cell sorting was performed on an ARIA 3 (BD Biosciences) apparatus on single-cell suspensions from spleens or Peyer’s patches ...
-
bioRxiv - Cancer Biology 2022Quote: ... human PBMCs (3×105 cells/condition) were incubated with CD8 (BD, 562428), CD25 (BD ...
-
bioRxiv - Immunology 2022Quote: ... perflava was cultured on Gonococcal medium base (GCB, BD #DF0289-17-3) plus Kellogg’s supplements [63] at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... GATA-3 (TWAJ, eF660, eBioscience, or L50-829, PE-Cy7, BD Biosciences), T-bet (4B10 ...
-
bioRxiv - Microbiology 2024Quote: ... single colonies were inoculated into 3 ml Tryptic Soy Broth (TSB, BD) with 10 µg/ml chloramphenicol (Cm10 ...
-
bioRxiv - Cell Biology 2024Quote: ... then sort-matched for GFP using a FACSMelody 3-laser sorter (BD).
-
bioRxiv - Immunology 2024Quote: ... was prepared and loaded into a 3 mL syringe (BD Biosciences, #309657). Primer-conjugated agarose was completely melted at 95°C for over 2 hours and subsequently loaded into a 3 mL syringe ...
-
bioRxiv - Genetics 2022Quote: ... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were stained with an activated caspase-3 antibody (BD Biosciences, anti:Rabbit) to mark apoptotic cells ...
-
bioRxiv - Immunology 2023Quote: ... anti-Active Caspase 3 BV650 (1:200, clone C92-605, BD Biosciences); anti-BCL-xL PE (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed using FCAP Array software v.3 (BD Biosciences).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Biophysics 2024Quote: ... sealed at the other end by a 0.6x30mm needle (BD, microlance 3) attached to a 3mL syringe (Braun ...
-
bioRxiv - Microbiology 2024Quote: ... Parasitaemia was scored using flow cytometry (FACS Aria 3, BD Biosciences, USA) on glutaraldehyde-fixed samples ...
-
bioRxiv - Immunology 2024Quote: ... stained with FITC-conjugated Ab specific for cleaved caspase-3 (BD Biosciences), rinsed ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...