Labshake search
Citations for Becton, Dickinson and Company :
701 - 735 of 735 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were washed with Hank’s buffered saline solution and resuspended in 2mM EDTA/ 2% BSA/ PBS buffer containing [2µg/mL] propidium iodide (PI) (BD Biosciences, Cat. No. 556364) and [1µM] Calcein violet (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... 1ml diluted blood was transferred into a clean 15ml-tube and incubated with 9ml 1x red blood cells lysing solution (BD Pharm Lyse, 555899) at room temperature for 15min avoiding light ...
-
bioRxiv - Cancer Biology 2023Quote: ... Intracellular staining was performed after fixation and permeabilisation of the cells using FOXP3 Fixation/Permeabilisation Solution kit (BD Biosciences, Frankin Lakes, NJ, USA) using manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed twice with 200µl BD 1X Perm/Wash solution and stained 1h at 4°C with anti-HIV-1 p24 (RD1/PE, Beckman Coulter #6604667, 1:100 in 1X BD Perm/wash solution) or anti-BST2 (Proteintech #13560-1-AP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 mL of 0.1% FBS/PBS was added to the cell suspension and the solution was passed through a BD Falcon 70μm strainer (BD Biosciences, San Jose, CA) to remove any undigested tissue ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed with PBS and staining solution before they were fixed and permeabilized according to the manufacturer’s instructions (BD Biosciences, San Diego, CA). Cells were subsequently stained with anti-BrdU antibody solution at room temperature for 20 min ...
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: The coding sequence of MYC2 PCR-amplified from cDNA using PHANTA was fused with GAL4 DNA-binding domain (BD) of the bait vector pGBKT7 (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmid transduction into the above-mentioned yeast strains was confirmed by PCR (KK70/CY179 for AGB1.x-BD, KK281/CY180 for AGG1-AD ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were incubated overnight at 4°C in solution containing 1% BSA and primary antibodies: mouse F4/80 (T45-2342, BD Biosciences, New Jersey, USA) 1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The base of the UC of the CIM plate was coated with 20% solution of a basement membrane matrix (BD Matrigel, BD Biosciences, San Jose, CA) in serum-free medium ...
-
bioRxiv - Immunology 2021Quote: ... surface stained, fixed with 4% formaldehyde solution (Tousimis, Rockville, MD) and fluorescence was evaluated on an LSRII flow cytometer (BD Bioscience, San Jose, CA). Antibodies used for flow cytometry included anti-human CD3 AF700 (clone UCHT1) ...
-
bioRxiv - Immunology 2021Quote: ... the cells were fixed with 2% formaldehyde solution (Tousimis, Rockville MD) and fluorescence was evaluated on an LSRII flow cytometer (BD Bioscience, San Jose, CA). The phagocytic score was calculated by multiplying the percentage of bead-positive cells by the geometric mean of the fluorescence intensity of bead-positive cells and dividing by 10,000.
-
bioRxiv - Immunology 2020Quote: ... cells were fixed and permeabilized for 30 min at 4 °C in the dark after extracelluar stainings using BD Cytofix/Cytoperm (Fixation and Permeabilization Solution, BD Biosciences, Cat: 51-2090KZ) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The cells were incubated for 30 min at room temperature in the staining solution before being subjected to flow cytometry analysis (FACSCalibur, BD Biosciences, San Jose, CA).
-
bioRxiv - Cancer Biology 2022Quote: ... cells were washed twice with PBS and then resuspended in 100 μl of staining solution of FACS buffer containing biotinylated antibodies against CD31 (BD Biosciences, 558737, 1:100), CD45 (BD Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... After 19h incubation at 37°C, the cells were fixed with 2% formaldehyde solution (Tousimis, Rockville, MD) and fluorescence was evaluated on a LSRII (BD Bioscience, San Jose, CA). The phagocytic score was calculated by multiplying the percentage of bead-positive cells by the geometric mean fluorescence intensity (MFI ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells grown on 96 well plates were fixed and permeabilized for 20 mins at 4°C with Fixation/Permeabilization solution (BD Biosciences, cat. no. 554714). Cells were washed 3 times in PBS ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... A non-traumatic micro-serrefine clamp was placed on the renal artery and vein and 50 μL of AAV vector solution was injected using a 31-gauge needle (328468, BD Medical, Franklin Lakes, NJ). Ischemic time required for the injection is less than 1 min ...
-
bioRxiv - Immunology 2023Quote: ... Following surface staining cells were fixed and permeabilized using a BD Cytofix/ Cytoperm Fixation/ Permeabilization Solution kit (Cat# 554714 BD Biosciences, Franklin Lakes NJ) followed by intracellular staining with anti-IFNγ ...
-
Angiogenesis in the mature mouse cortex is governed in a region specific and Notch1 dependent mannerbioRxiv - Neuroscience 2024Quote: ... sections were incubated overnight in 0.1M PBS + 0.1% TX-100 solution containing primary antibody for rat anti-CD31 (label endothelial cells; 1:200 dilution, BD Clone MEC 13:3: #553370) or sheep anti-CD93 (label endothelial tip cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then washed twice with PBS and incubated with propidium iodide staining solution (2.5 μg/mL PI (BD Biosciences, Franklin Lakes, NJ, USA), 100 µg/mL RNAse A (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... the isolated cells with fluorescence signals were sorted and enriched directly into 0.2-μl PCR tubes by a FACS machine (BD Influx). Noted that ...
-
bioRxiv - Plant Biology 2022Quote: ... and the PCR products were fused into the activation domain (AD) vector pGADT7 and/or the DNA-binding domain (BD) vector pGBKT7 and verified by sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... the truncated HAF2 coding regions were obtained by RT-PCR from Col-0 cDNA and then cloned into pEXPAD502 (AD) and pDBLeu (BD) backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 µL of PI (from 50 µg/ml stock solution) was then added and the cell cycle was analyzed by flow cytometry (BD FACSCanto™ II, BD Bioscience) using untreated cells as negative control for gating ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were washed with FACS buffer and mammalian cells were permeabilized for 20 minutes at 4°C with BD Fix/Perm solution (BD Biosciences, Franklin Lakes, NJ, USA) and washed with 1X BD Perm/Wash buffer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... P33681) without the leader sequence was PCR-amplified and cloned into the pAcGP67 of the BaculoGold Baculovirus Expression System (BD Biosciences). This vector was modified so that all proteins featured a C-terminal H12-tag ...
-
bioRxiv - Genetics 2024Quote: ... and CNM67 (∼1746 bp) were PCR amplified and cloned in frame with the Gal4 activation/ DNA binding domain (AD or BD domain) in pGADC1 and pGBDC1 respectively at BamHI and SalI sites using oligos listed in Supplementary file 2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The base of the UC of the CIM plate was coated with 20% solution of a basement membrane matrix (BD Matrigel, BD Biosciences, San Jose, CA) in serum-free medium ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with primary antibody solutions for 5 days at 4°C: mouse monoclonal antiNMDAR1 (GluN1) (1:200; 556308, PharMingen, Becton, Dickinson and Company, Frankline Lakes, USA) or rabbit polyclonal antiNMDAa1 (GluN2A ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Immunology 2024Quote: ... a sample of bulk tank milk before vaccination was also collected and analysed by PCR and ELISA (CIVTEST Bovis BVD/BD p80; HIPRA) by an external laboratory ...
-
bioRxiv - Microbiology 2022Quote: ... Agar dilution was performed with Mueller Hinton agar for Escherichia coli and GC agar supplemented with hemoglobin solution and BBL™ IsoVitaleX™ (Becton, Dickinson and Company, Le Pont de Claix, France) for Neisseria gonorrhoeae with increasing concentrations of nitroxoline ...