Labshake search
Citations for Becton, Dickinson and Company :
651 - 700 of 1553 citations for hsa mir 373 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Then immunostaining was performed using a CytofixCytoperm kit (BD) and the following monoclonal antibodies ...
-
bioRxiv - Immunology 2020Quote: ... using the Cytofix/Cytoperm fixation/permeabilization solution kit (BD) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 ELISA kits (BD Biosciences, Palo Alto, CA), IL-1β ...
-
bioRxiv - Immunology 2020Quote: ... and analyzed with CBA analysis kit (BD, Carlsbad, CA), according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... A cytometric bead-based multiplex assay kit (BD Biosciences) was used to measure the concentration of IFN-γ ...
-
bioRxiv - Immunology 2020Quote: ... was performed using the Cytofix/Cytoperm kit (BD Biosciences) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and stained with a Phosflow staining kit (BD Biosciences) using the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... according to the manufacturer’s protocol (BD Cytofix/Cytoperm kit).
-
bioRxiv - Immunology 2022Quote: ... following the BrdU Flow Kit manufacturer’s instructions (BD Pharmingen). For Ki67 analysis ...
-
bioRxiv - Immunology 2022Quote: ... and treated with a Cytofix/Cytoperm kit (BD Biosciences) per manufacturer protocol.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Human IL-1β ELISA kit was obtained from BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: A human Th1/Th2/Th17 Cytokine Kit (BD Biosciences) was used to measure the production of cytokines as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... fixed/permeabalized using the BD cytofix/cytoperm kit (BD), and stained with anti-IFNγ (XMG1.2 ...
-
bioRxiv - Immunology 2023Quote: ... intracellular staining was performed using Citofix/CytopermTM kit (BD) following manufacturer instructions and using the following antibodies ...
-
bioRxiv - Immunology 2023Quote: ... the BD Cytofix/Cytoperm kit (BD Biosciences Cat. 554714) and FOXP3 Transcription Factor Staining Buffer set (eBioscience Cat ...
-
bioRxiv - Immunology 2023Quote: ... mouse and human IFNγ OptEIA ELISA Kits (BD Biosciences) were used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... CytoFix/CytoPerm and Perm/Wash Buffer kit (BD, 554714) was used for intracellular staining steps ...
-
bioRxiv - Bioengineering 2022Quote: ... IFNγ and TNFα ELISA kit were purchased from BD Biosciences (San Jose ...
-
bioRxiv - Immunology 2022Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences) prior to acquisition using FACSymphony ...
-
bioRxiv - Immunology 2023Quote: ... by using Cytofix/CytoPerm Plus kit (555028; BD Pharmingen). Samples were analyzed using a Fortessa flow cytometer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using the Fixation/Permeabilization Kit (BD Biosciences #554714), and stained intracellularly ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using a Cytofix/Cytoperm solution kit (BD Biosciences), and intracellularly stained with anti-TNF-Alexa 700 (alone MAB11) ...
-
bioRxiv - Immunology 2023Quote: ... FITC-anti-BrdU (BD, BrdU flow kit, Cat#559619), Zombie Aqua fixable viability kit (BioLegend ...
-
bioRxiv - Pathology 2023Quote: ... WBC were quantified using the Leucocount Kit (BD, 340523). Platelet unit pH was measured daily by adding 25 μL of the platelet unit to pH strips with a pH range of 5-9 (Fisher ...
-
bioRxiv - Immunology 2023Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... using Cytofix/Cytoperm Fixation/Permeabilization Solution kit (BD Biosciences) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Viability was analyzed with Kit 7AAD/Annexin (BD Pharmingen), according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The Cytokine Bead Array kit was procured from BD Biosciences ...
-
bioRxiv - Developmental Biology 2024Quote: ... labeled with Mouse Immune Single-Cell Multiplexing Kit (BD) and loaded on a microwell cartridge of the BD Rhapsody Express system (BD ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cancer Biology 2021Quote: Cell cycle analysis was performed using the BrdU Flow Kit according to the manufacturer protocol (BD, FITC BrdU Flow Kit; Cat. No. 559619), with cells pulsed with BrdU for 1 hour at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: pEU-E01 cell-free wheat germ expression vector containing ampicillin resistance and cell-free wheat germ expression kit (Cat# CFS-CPLE-BD Proteoliposome BD Kit) were obtained from CellFree Sciences Co. ...
-
bioRxiv - Immunology 2021Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2019Quote: ... HSPCs were stained using c-Kit-APC (2B8; BD Biosciences), Sca-1-Cy7PE (D7 ...
-
bioRxiv - Bioengineering 2019Quote: ... Monocytes were enriched by using monocytes enrichment kit (BD biosciences) according to the manufacture instructions ...
-
bioRxiv - Immunology 2019Quote: The Cytokine Bead Array Mouse Inflammation kit (BD Biosciences 552364) was used according to manufacturer’s instructions for simultaneous measurement of IL-6 ...
-
bioRxiv - Immunology 2020Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2019Quote: ... Cells were permeabilised with Cytofix/Cytoperm kit (BD Biosciences, USA) accordingly to the manufacturer protocol and stained with monoclonal antibodies targeting IFN-γ (BD Bioscience ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by mild fixation and permeabilization using the Cytofix and Cytoperm solutions from BD Cytofix/Cytoperm™ Fixation/ Permeabilization Solution Kit (BD biosciences, BDB554714) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then analyzed with BrdU-APC Flow Kit (BD Biosciences) as described previously (24).
-
bioRxiv - Molecular Biology 2021Quote: ... BD Cytofix/Cytoperm™ kit (BD Biosciences, San Jose, CA) was used following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... fixed and permeabilized using Fixation/Permeabilization Solution Kit (BD Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and stained using a PE BrdU flow kit (BD Biosciences). For coculture experiments and proliferation experiments ...
-
bioRxiv - Immunology 2019Quote: ... Barcoded oligo-conjugated antibodies (single-cell multiplexing kit; BD Biosciences) were used to infer origin of sample (ie ...
-
bioRxiv - Neuroscience 2021Quote: The cytokine bead array mouse inflammation kit (BD Biosciences, USA) was used for the determination of cytokine levels in brain lysate and plasma samples according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... followed by permeabilization with Cytofix/cytoperm kit solution (BD Biosciences) and staining with anti-IFN-γ (BD Biosciences Cat#554702) ...
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with the Cytofix/Cytoperm Kit (BD Biosciences), and stained for intracellular IFNγ using APC-XMG1.2 (eBioscience).
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with an intracellular cytokine staining kit (BD) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... permeabilized with cytofix/cytoperm Kit (BD Biosciences, Cat. no: 554714), and then stained with anti-Ki-67 antibody ...