Labshake search
Citations for Becton, Dickinson and Company :
601 - 650 of 2562 citations for Acetaldehyde 3a 4 5 6 7 7a hexahydro 4 7 methano 1H inden 5 yl oxy since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 7 days post-vaccination) and measured Cytokines using the BD CBA Mouse Th1/Th2/Th17 Cytokine Kit (BD Bioscience, San Jose, CA, USA). Sera samples were processed as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... The nuclei were then stained with 7-AAD and subjected to sorting using a BD FACSMelody cell sorter (BD Biosciences, Franklin Lakes, NJ). Single-nucleus RNA-seq libraries were prepared using Chromium Single Cell 3’ Reagent Kits V3 (10x Genomics ...
-
bioRxiv - Physiology 2024Quote: ... The nuclei were then stained with 7-AAD and subjected to sorting using a BD FACSMelody cell sorter (BD Biosciences, Franklin Lakes, NJ). Up to 16,000 nuclei were used with the Chromium Next GEM Single Cell Multiome ATAC + Gene Expression kit (10x Genomics ...
-
bioRxiv - Immunology 2021Quote: ... for 4 h in presence of Golgi Plug (BD Pharmingen). For CD4+T cells isolation from spleen ...
-
bioRxiv - Immunology 2022Quote: ... TCR Vβ5.1/5.2-PE (BD Bioscience: 562088, clone: MR9-4), TCR Vβ6-BV421 (BD Bioscience ...
-
bioRxiv - Bioengineering 2020Quote: ... they were analyzed using a Fortessa 4-15 (BD Biosciences) with a High Throughput Screening module.
-
bioRxiv - Neuroscience 2021Quote: ... Ly-6C (clone 1A8, BV510, 4 µg/ml, BD Biosciences), F4/80 (clone BM-8 ...
-
bioRxiv - Pathology 2021Quote: ... MHC II (anti-mouse, clone 14- 4-4S, BD Biosciences), and a Live/Dead discriminator (Fixable Near-IR Dead Cell Stain Kit ...
-
bioRxiv - Immunology 2020Quote: ... 4°C with Brilliant Violet Buffer (BD Biosciences, Cat# 566349) at 1/4 in PBS-FBS 1% (see Supplemental Table 3 for antibody staining panel).
-
bioRxiv - Immunology 2020Quote: ... CD4-PerCP-Cy5.5 mAb (clone 74-12-4, BD Bioscience) and CD8β-FITC mAb (clone PPT23 ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... and CD184/CXCR-4-BIOTIN (BD Biosciences [Lot 6336587; 551968]). Cells were then washed ...
-
bioRxiv - Immunology 2020Quote: ... at 4 °C before flow cytometry on a FacsCanto (BD). Data was analyzed using FlowJo software (Version 10 ...
-
bioRxiv - Immunology 2021Quote: ... 8 color (4-2-2) configuration (BD Bioscience, Heidelberg, Germany). The system automatically adjusts spillover values for the compensation of standard fluorochromes ...
-
bioRxiv - Immunology 2021Quote: ... fixed for 10 mins in 4% formaldehyde (BD Biosciences Cytofix), washed in PBS and acquired on a BD FACSCelesta Cell Analyzer ...
-
bioRxiv - Immunology 2021Quote: Blood was obtained in 4 ml EDTA tubes (BD Biosciences). Absolute counts of total monocytes in whole blood were obtained using trucount beads (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... with soluble anti-CD28 (CD28.2, 4 μg/ml; BD Biosciences). Dynabead-activated cells were magnetically de-beaded immediately prior to electroporation ...
-
bioRxiv - Immunology 2021Quote: ... from Invitrogen and IL-4 (11B11) and IFN-γ (XMG1.2) from BD. Cells were analysed on LSR II flow cytometer (BD) ...
-
bioRxiv - Immunology 2020Quote: ... PE conjugated anti-monkey IL-4 (8D4-8, BD, 551774), and PE conjugated anti-monkey TNF-a (MAb11 ...
-
bioRxiv - Immunology 2020Quote: ... CD4-PerCP-Cy5.5 mAb (clone 74-12-4, BD Bioscience) and CD8α-PE mAb (clone 76-2-11 ...
-
bioRxiv - Immunology 2021Quote: ... CD8 BUV496 or BV650 (2:100 or 4:100; BD Biosciences Cat# 612942 or Biolegend Cat# 301042) ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of GolgiStop (4 μl/6mL; BD Biosciences) for 3-4 hours ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 4 mg/ml Mycobaterium tuberculosis H37Ra (BD Difco) and 200 μg MOG35-55 peptide (MEVGWYRSPFSRVVHLYRNGK ...
-
bioRxiv - Immunology 2023Quote: ... following a 4 h treatment with Golgistop and Golgiplug (BD), cells were stained for analysis on day 4.
-
bioRxiv - Cancer Biology 2023Quote: ... Data were acquired on a LSRFortessa 4-15 (BD Biosciences), LSRFortessa X-20 (BD Biosciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... Anti-CD95L antibody (G247-4, #556387) was acquired from BD Bioscience ...
-
bioRxiv - Cancer Biology 2024Quote: ... they were either fixed with 4% formaldehyde-containing buffer (BD) for thirty minutes or immediately stained for surface markers and then fixed ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-Oct3/4 conjugated to AlexaFluor555 (BD Biosciences cat # 560306) at 1:100 ...
-
bioRxiv - Immunology 2024Quote: ... APC–conjugated anti-human CD152/CTLA-4 (BNI3) (BD Biosciences), Alexa Fluor 488–conjugated anti-human Helios (22F6 ...
-
bioRxiv - Immunology 2024Quote: ... mice were administrated (i.p.) with 4% (v/v) thioglycollate (BD) for 4 h before sacrifice ...
-
bioRxiv - Molecular Biology 2024Quote: ... incubated overnight at 4°C with primary antibody (Tom20; BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... and Brilliant Violet 650 anti-mouse IL-4 (BD Biosciences) and analyzed via flow cytometry as we have described in our previous studies (27 ...
-
bioRxiv - Cancer Biology 2024Quote: ... APC- R700-CTLA-4 (Clone: UC10-4F10-11 BD Biosciences), APC-Fire 750-Granzyme B (Clone ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4% (v/v) Matrigel (growth-factor-reduced; BD Biosciences). Medium was refreshed every 2-3 days with medium that did not contain Y-27632 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mix 4: AlexaFluor 700 anti-CD45 (1:150, BD Biosciences), BB515 anti-CD11b (1:100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Microbiology 2022Quote: ... 5 times with a 1 mL syringe (BD, Spain). This was the control sample.
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...