Labshake search
Citations for Becton, Dickinson and Company :
601 - 650 of 2472 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... at 4 °C before flow cytometry on a FacsCanto (BD). Data was analyzed using FlowJo software (Version 10 ...
-
bioRxiv - Immunology 2021Quote: ... 8 color (4-2-2) configuration (BD Bioscience, Heidelberg, Germany). The system automatically adjusts spillover values for the compensation of standard fluorochromes ...
-
bioRxiv - Immunology 2021Quote: ... fixed for 10 mins in 4% formaldehyde (BD Biosciences Cytofix), washed in PBS and acquired on a BD FACSCelesta Cell Analyzer ...
-
bioRxiv - Immunology 2021Quote: Blood was obtained in 4 ml EDTA tubes (BD Biosciences). Absolute counts of total monocytes in whole blood were obtained using trucount beads (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... with soluble anti-CD28 (CD28.2, 4 μg/ml; BD Biosciences). Dynabead-activated cells were magnetically de-beaded immediately prior to electroporation ...
-
bioRxiv - Immunology 2021Quote: ... from Invitrogen and IL-4 (11B11) and IFN-γ (XMG1.2) from BD. Cells were analysed on LSR II flow cytometer (BD) ...
-
bioRxiv - Immunology 2020Quote: ... PE conjugated anti-monkey IL-4 (8D4-8, BD, 551774), and PE conjugated anti-monkey TNF-a (MAb11 ...
-
bioRxiv - Immunology 2020Quote: ... CD4-PerCP-Cy5.5 mAb (clone 74-12-4, BD Bioscience) and CD8α-PE mAb (clone 76-2-11 ...
-
bioRxiv - Immunology 2021Quote: ... CD8 BUV496 or BV650 (2:100 or 4:100; BD Biosciences Cat# 612942 or Biolegend Cat# 301042) ...
-
bioRxiv - Immunology 2023Quote: ... following a 4 h treatment with Golgistop and Golgiplug (BD), cells were stained for analysis on day 4.
-
bioRxiv - Biochemistry 2023Quote: ... Anti-CD95L antibody (G247-4, #556387) was acquired from BD Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... in the presence of GolgiStop (4 μl/6mL; BD Biosciences) for 3-4 hours ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 4 mg/ml Mycobaterium tuberculosis H37Ra (BD Difco) and 200 μg MOG35-55 peptide (MEVGWYRSPFSRVVHLYRNGK ...
-
bioRxiv - Cancer Biology 2023Quote: ... Data were acquired on a LSRFortessa 4-15 (BD Biosciences), LSRFortessa X-20 (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... mice were administrated (i.p.) with 4% (v/v) thioglycollate (BD) for 4 h before sacrifice ...
-
bioRxiv - Molecular Biology 2024Quote: ... incubated overnight at 4°C with primary antibody (Tom20; BD Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: ... Anti-Oct3/4 conjugated to AlexaFluor555 (BD Biosciences cat # 560306) at 1:100 ...
-
bioRxiv - Immunology 2024Quote: ... APC–conjugated anti-human CD152/CTLA-4 (BNI3) (BD Biosciences), Alexa Fluor 488–conjugated anti-human Helios (22F6 ...
-
bioRxiv - Immunology 2024Quote: ... and Brilliant Violet 650 anti-mouse IL-4 (BD Biosciences) and analyzed via flow cytometry as we have described in our previous studies (27 ...
-
bioRxiv - Cancer Biology 2024Quote: ... they were either fixed with 4% formaldehyde-containing buffer (BD) for thirty minutes or immediately stained for surface markers and then fixed ...
-
bioRxiv - Cancer Biology 2024Quote: ... APC- R700-CTLA-4 (Clone: UC10-4F10-11 BD Biosciences), APC-Fire 750-Granzyme B (Clone ...
-
bioRxiv - Neuroscience 2024Quote: ... Mix 4: AlexaFluor 700 anti-CD45 (1:150, BD Biosciences), BB515 anti-CD11b (1:100 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4% (v/v) Matrigel (growth-factor-reduced; BD Biosciences). Medium was refreshed every 2-3 days with medium that did not contain Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1×106 293FT cells were plated into 6-well plate coated with collagen I (BD Bioscience, #354236), transfection was performed with retroviral constructs together with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Developmental Biology 2021Quote: ... non-adherent bone marrow cells were seeded in triplicate in 6-well collagen-coated plates (BD Biosciences) at a density of 1×105 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... P was analyzed (as molybdate reactive P) in the 6 extracts (referred to as H2O-P, BD-P ...
-
bioRxiv - Immunology 2020Quote: ... then stained with the antibodies described in Supplementary Table 6 and analysed on the LSRII (BD Bioscience). Data were analysed with the FlowJo v10.4.2 software (FlowJo LLC).
-
bioRxiv - Microbiology 2020Quote: ... and IFN-γ secreted by splenocytes of C57BL/6 mice were determined using ELISPOT kits (BD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a final concentration of 10 μg/ml Brefeldin A and 6 μg/ml Golgi-Stop (BD Biosciences) were added ...
-
bioRxiv - Genomics 2022Quote: ... Stained cells were analyzed using a BD LSRII Fortessa equipped with FACSDiva software (Version 6) (BD Pharmingen). Samples were acquired using Fortessa’s HTS plate reader option at an event rate below 20,000 events/s ...
-
bioRxiv - Cancer Biology 2024Quote: ... Between 3 to 6 sections of each tumor were also immunostained for Ki67 (mouse anti-ki67, BD, San Jose CA ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated with an antibody mix (1:200 HAL-DR-BUV615 (G46-6, 751142, BD Optibuild), 1:600 CD206-BUV661 (19.2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... DNA was denatured in 2 M hydrochloric acid and stained with FITC-conjugated BrdU antibody (556028, BD Biosciences) and propidium iodide (MilliporeSigma ...
-
bioRxiv - Systems Biology 2020Quote: ... CSP consists of 1.7 g/L Yeast Nitrogen Base without Amino Acids and Ammonium Sulfate (BD Difco(tm)) ...
-
bioRxiv - Immunology 2022Quote: About 8 ml of blood was collected in acid citrate dextrose (ACD) tubes (Cat. Number 364606, BD Biosciences) for platelet isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mtb was grown in Middlebrook 7H9 supplemented with 10% (v/v) oleic acid/dextrose/catalase supplement (OADC; BD), 0.2% (v/v ...
-
bioRxiv - Physiology 2022Quote: ... 0.1 nM retinoic acid) supplemented with 1x penicillin/streptomycin and 2% NuSerum (BD Biosciences/Corning, San Jose, CA) as described.(50 ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole blood was collected by venipuncture into acid-citrate-dextrose (ACD) vacutainers (BD Biosciences, Franklin Lakes, NJ, USA). Blood was supplemented with 0.5 µM prostaglandin E1 (Cayman Chemical) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% v/v OADC (Oleic acid, Albumin, Dextrose, Catalase) enrichment medium (BD Biosciences, Franklin Lakes, USA) to logarithmic growth phase (OD600 0.2 - 0.4 ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% v/v OADC (Oleic acid, Albumin, Dextrose, Catalase) enrichment medium (BD Biosciences, Franklin Lakes, USA), 0,2% v/v Glycerol and 0,05% v/v Tween 80 to logarithmic growth phase (OD600 0.2 - 0.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...