Labshake search
Citations for Becton, Dickinson and Company :
551 - 600 of 1921 citations for R 3 Amino 5 hexynoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized using Phosphoflow Fix Buffer 1 and Perm Buffer 3 (BD Biosciences) and stained with antibodies raised against phosphorylated mTOR (Ser2448 ...
-
bioRxiv - Genetics 2021Quote: ... ∼3 x 105 MATα spores were sorted by FACS (BD FACSAria II) based on the absence of RFP fluorescence signal measured using a 561 nm laser and 582/15 optical filter ...
-
bioRxiv - Physiology 2022Quote: ... 1:500 for Purified mouse anti-Smad2/3 (610843, BD Biosciences, USA), 1:1000 for Phospho-AKT (Ser473 ...
-
bioRxiv - Developmental Biology 2022Quote: ... A purified primary rabbit anti-active caspase-3 antibody (BD Biosciences, 559565) was diluted 1:500 in blocking solution and embryos were incubated overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... and rabbit anti-activated Caspase-3 (Fisher Scientific/BD, BDB559565, 1:500). Antibody used for fluorescent in situ hybridization was mouse anti-Dig (Jackson ImmunoResearch 200-002-156 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse lung cryosections were stained overnight with anti-BrdU (1:3, BD Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... transwells were pre-coated with Matrigel (1:3 in DMEM, BD Biosciences), assays were performed with 1.5 × 104 cells plus 0.5 μg/μl mitomycin C for 72 h using 10 μg/ml collagen and 20% FBS as chemo-attractants ...
-
bioRxiv - Immunology 2022Quote: ... we added 3 μL of anti-CD123-APC (clone 7G3, BD Bioscience), 4 μL of anti-CD45-PE (clone HI30 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and mouse anti-human LAG-3 conjugated to BV421 (BD Biosciences, 565721). Antibodies used for mouse cells are rat anti-mouse CD8a conjugated to FITC (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... Cleaved caspase-3 (Essen Bioscience, 4704) and CD45 (BD Pharmingen™, 553076) staining was performed according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then stained with anti-cleaved caspase 3-PE (BD #550821) and anti-GATA1 (Abcam ab181544 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were exposed to anti-CD40 (1ug/ml, BD Clone HM40-3) and rIL-4 (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... Flow cytometry cell sorting was performed on an ARIA 3 (BD Biosciences) apparatus on single-cell suspensions from spleens or Peyer’s patches ...
-
bioRxiv - Cancer Biology 2022Quote: ... human PBMCs (3×105 cells/condition) were incubated with CD8 (BD, 562428), CD25 (BD ...
-
bioRxiv - Immunology 2022Quote: ... perflava was cultured on Gonococcal medium base (GCB, BD #DF0289-17-3) plus Kellogg’s supplements [63] at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... GATA-3 (TWAJ, eF660, eBioscience, or L50-829, PE-Cy7, BD Biosciences), T-bet (4B10 ...
-
bioRxiv - Microbiology 2024Quote: ... single colonies were inoculated into 3 ml Tryptic Soy Broth (TSB, BD) with 10 µg/ml chloramphenicol (Cm10 ...
-
bioRxiv - Cell Biology 2024Quote: ... then sort-matched for GFP using a FACSMelody 3-laser sorter (BD).
-
bioRxiv - Immunology 2024Quote: ... was prepared and loaded into a 3 mL syringe (BD Biosciences, #309657). Primer-conjugated agarose was completely melted at 95°C for over 2 hours and subsequently loaded into a 3 mL syringe ...
-
bioRxiv - Genetics 2022Quote: ... and anti-CD233 (band 3; IBGRL) antibodies and 7-AAD (BD Biosciences) for cell death assessment ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were stained with an activated caspase-3 antibody (BD Biosciences, anti:Rabbit) to mark apoptotic cells ...
-
bioRxiv - Immunology 2023Quote: ... anti-Active Caspase 3 BV650 (1:200, clone C92-605, BD Biosciences); anti-BCL-xL PE (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed using FCAP Array software v.3 (BD Biosciences).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Immunology 2024Quote: BD Microlance 3-26G x ½” needle for syringe (BD Biosiences, Ref. 560365).
-
bioRxiv - Biophysics 2024Quote: ... sealed at the other end by a 0.6x30mm needle (BD, microlance 3) attached to a 3mL syringe (Braun ...
-
bioRxiv - Microbiology 2024Quote: ... Parasitaemia was scored using flow cytometry (FACS Aria 3, BD Biosciences, USA) on glutaraldehyde-fixed samples ...
-
bioRxiv - Immunology 2024Quote: ... stained with FITC-conjugated Ab specific for cleaved caspase-3 (BD Biosciences), rinsed ...
-
bioRxiv - Genomics 2024Quote: ... or with the appropriate class control antibodies: PE Mouse anti-IgG1 κ R-PE Clone MOPC-21 (BD Biosciences) and Alexa Fluor® 647 Mouse anti IgG1 κ Isotype Clone MOPC-21 (BD Biosciences) ...
-
bioRxiv - Cell Biology 2023Quote: ... the following were also supplemented: 20 ng/mL brain-derived neurotrophic factor (BDNF; R&D systems, catalog #: 248-BD), 20 ng/mL glial cell line-derived neurotrophic factor (GDNF ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... DNA was denatured in 2 M hydrochloric acid and stained with FITC-conjugated BrdU antibody (556028, BD Biosciences) and propidium iodide (MilliporeSigma ...
-
bioRxiv - Immunology 2022Quote: About 8 ml of blood was collected in acid citrate dextrose (ACD) tubes (Cat. Number 364606, BD Biosciences) for platelet isolation ...
-
bioRxiv - Physiology 2022Quote: ... 0.1 nM retinoic acid) supplemented with 1x penicillin/streptomycin and 2% NuSerum (BD Biosciences/Corning, San Jose, CA) as described.(50 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mtb was grown in Middlebrook 7H9 supplemented with 10% (v/v) oleic acid/dextrose/catalase supplement (OADC; BD), 0.2% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole blood was collected by venipuncture into acid-citrate-dextrose (ACD) vacutainers (BD Biosciences, Franklin Lakes, NJ, USA). Blood was supplemented with 0.5 µM prostaglandin E1 (Cayman Chemical) ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% v/v OADC (Oleic acid, Albumin, Dextrose, Catalase) enrichment medium (BD Biosciences, Franklin Lakes, USA) to logarithmic growth phase (OD600 0.2 - 0.4 ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with 10% v/v OADC (Oleic acid, Albumin, Dextrose, Catalase) enrichment medium (BD Biosciences, Franklin Lakes, USA), 0,2% v/v Glycerol and 0,05% v/v Tween 80 to logarithmic growth phase (OD600 0.2 - 0.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... and mouse anti-BrdU (1:5, 347580, BD Bioscience) for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...