Labshake search
Citations for Becton, Dickinson and Company :
551 - 600 of 8463 citations for 8 BROMO 4 METHYLTHIO 7 PHENYLPYRAZOLO 1 5 A 1 3 5 TRIAZIN 2 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Cells were resuspended in 1 ml of ice-cold PBS and 10 µl of 7-AAD (BD Pharmingen) were added for dead cells discrimination ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β1/2-adaptin (BD Biosciences #610381; 1:5000), mouse anti-γ-adaptin (made from 100/3 hybridoma ...
-
bioRxiv - Bioengineering 2022Quote: ... mouse anti-ezrin/villin-2 (BD #610602, 1:200 dilution), rabbit anti-Na+K+ATPase (Abcam #ab76020 ...
-
bioRxiv - Immunology 2020Quote: ... phospho JNK1/2 (T182/Y185) (dilution 1:200) (558268, BD), phospho cJun (S63 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... clone 2 (1:1000; mouse monoclonal, IgG1, BD Biosciences, 610061) at 4°C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-BCL-2 (1:1,000, mouse mAb, BD bioscience, 610538), anti-JNK1 (1:1,000 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg/ml trypsin and 1% Bacto-Agar (BD, 214010) and incubated for 3 days at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... Tumor xenografts were inoculated subcutaneously on both flanks with 2.3 × 105 cells (MDA-MB-231) in a final volume of 100?μL of 1:1 DMEM and matrigel (BD). Tumor growth was routinely monitored using calipers to ensure the tumor weight not exceeding 10% of body weight ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1×106 BxPC-3 or PANC-1 cells were suspended in 40 μL mixed cell culture media and Matrigel (BD) at a 1:1 ratio and injected into the tail of the pancreas ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were dissected and dehydrated next day and were washed 3 times in PDT buffer (0.3 Triton-X in PBST with 1% DMSO) and incubated with Caspase-3 antibody (1:500; BD Biosciences) at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 7-AAD (7-aminoactinomycin D, cat# 559925, BD Pharmingen) was added at 1/250th v/v ...
-
bioRxiv - Immunology 2019Quote: ... 7-AAD (7-amino-actinomycin D) 0.5mg/L (BDbiosciences)or DAPI 1mg/L were used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... Viable 7-aminoactinomycin-D-excluding (7-AAD; BD Pharmingen) CD3-APC+ (eBioscience ...
-
bioRxiv - Immunology 2022Quote: ... and 7-amino-actinomycin D (7-AAD; BD Biosciences) to detect dead cells ...
-
bioRxiv - Bioengineering 2023Quote: ... pneumoniae serotype 3 (Sp3) (ATCC; Manassas, VA) was cultured on plates of BBL Trypticase Soy Agar with 5% sheep blood (BD Trypticase Soy Agar II) (BD Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... 98 mL of fresh MRS medium is then inoculated with 2 mL of the overnight culture and incubated at 37°C without shaking to an OD of 0.5-0.6 (ca. 4-5 hours) in a GasPak anaerobic jar (BD GasPak™ EZ container systems). Cells are harvested a first time by centrifugation at 4,000 g for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell suspensions were blocked for 5 min at 4 °C with rat anti-mouse CD16/CD32 (#553142, Mouse BD Fc Block, BD Biosciences) in FACS buffer ...
-
bioRxiv - Microbiology 2023Quote: ... We then create a 1 mm thick sheet of agarose using a 3 mL syringe (BD, 3 mL Luer lock) and a blunt needle (Industrial Dispensing Supplies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and BV421 mouse anti-human CD366 (TIM-3) (1:100; 565562, BD Biosciences).
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were incubated overnight in 1:3 diluted cytofix in PBS (BD 554655) at 4 degrees Celsius with agitation ...
-
bioRxiv - Bioengineering 2021Quote: ... Sections were incubated with rabbit anti-active caspase-3 (1:40, BD, 559565) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Caspase-3 monoclonal antibody (1:500, clone C92-605; BD Biosciences), Click-iT Tunel Alexa Fluor 647 (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-Oct3/4 human isoform A (BD Biosciences, 561628, 1:40) and rabbit anti-Phospho-Histone H2A.X (CST ...
-
bioRxiv - Immunology 2022Quote: Synovial tissue was fixed in 1:4 dilution Fixation/Permeabilization solution (BD Biosciences Cytofix/Cytoperm Cat No ...
-
bioRxiv - Neuroscience 2020Quote: ... fixed with 4% paraformaldehyde and stained (Syn1 antibody, BD Biosciences, 1:500) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Fluo-4 AM was from Thermo and Indo-1 AM from BD.
-
bioRxiv - Molecular Biology 2021Quote: ... between 500.000 and 1 million GFP-mCherry double positive cells were sorted each day for 5 consecutive days using two cell sorters (BD FACSAriaII SORP and BD FACSAriaIII). Sorted cells were pooled ...
-
bioRxiv - Microbiology 2023Quote: ... The amount of coating gp120 was optimized through competition by binding of the Leu3A (anti-CD4) antibody (clone SK3; Catalog no. 340133; Final dilution 1:5; BD Bioscience, San Jose, CA, USA). Cryopreserved peripheral blood mononuclear cells ...
-
bioRxiv - Microbiology 2021Quote: ... BV421-IL-8 (BD, G265-8).
-
bioRxiv - Immunology 2021Quote: ... anti-CD4-PE-Cy7 (BD Pharmigen, clone RM4-5), anti-CD4-V450 (clone RM4-5 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences), Monensin (BioLegend) ...
-
bioRxiv - Bioengineering 2019Quote: ... containing 5% (vol/vol) Nu-Serum I (BD Biosciences), 1% ITS+ Premix (BD Biosciences) ...
-
bioRxiv - Genomics 2020Quote: ... into 5 ml polystyrene round-bottom tubes (BD Falcon). Cells were sorted using the BD Influx™ (Becton Dickinson ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and CD4-Alexa Fluor 700 (RM4-5) from BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... Actin (Ab-5, 612652, lot 6176513, BD Transduction Laboratories) 1:10,000 ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2 in the presence of GolgiPlug (BD Biosciences) for intracellular cytokine staining ...
-
bioRxiv - Neuroscience 2020Quote: ... CD16/32 FcR block (5 μg/ml, BD Biosciences) was added followed by the appropriate antibody mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2017 with 5 % growth factor reduced Matrigel (BD, 354230). Media of the organoid culture plates was refreshed every 3-4 days ...
-
bioRxiv - Immunology 2022Quote: ... anti-AnnexinV-FITC antibody (5 µl, BD, #51-65874X), 7-AAD (5 µl ...
-
bioRxiv - Immunology 2022Quote: ... and 5 ng/ml mouse IL-12 (BD Biosciences)] in complete RPMI-1640 culture medium ...
-
bioRxiv - Immunology 2021Quote: ... or 5-Laser LSR II flow cytometers (BD Bioscences). Data were analyzed using FlowJo software (Tree Star).
-
bioRxiv - Developmental Biology 2021Quote: ... filter sterilized using a 5 mL syringe (309646, BD Vacutainer Labware Medical ...
-
bioRxiv - Immunology 2020Quote: ... anti-CD4-APC (clone RM4-5, BD Pharmingen #553051), anti-CD8α-Pacific Blue (clone 53-6.7 ...
-
bioRxiv - Microbiology 2022Quote: ... CD64 Brilliant Violet 786 (X54-5/7.1, BD Bioscience), MHC-II I-A/I-E Pacific Blue (M5/114.15.2) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was blocked in 5% skimmed milk (BD) and probed with rabbit polyclonal antibody against Gαq ...