Labshake search
Citations for Becton, Dickinson and Company :
451 - 500 of 2373 citations for 6 Chloro 9 fluorobenz 9 isoquinoline 5 10 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EPCAM)-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IL-4 (5 µg/mL; BD Biosciences); Th2 cells ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-AF647 (BD Pharmigen, X54-5/7.1), Anti-Siglec-F-PE (BD Pharmigen ...
-
bioRxiv - Molecular Biology 2024Quote: ... positive and CD45 (BD Biosciences, 555483, 1/5) negative MSC population (Giuliani et al. ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg/ml anti-ITGB1 (BD Bioscience) in BMMC culture media at 37°C and 5% CO2 for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), and anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6×108 cells were fixed with 30 ml BD Phosflow™ Fix Buffer I (BD Biosciences) for 20 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: iTF-Microglia were treated for 6 h with 1:2000 GolgiPlug™ (BD; Cat. No. 555029) or DMSO as control before dissociating ...
-
bioRxiv - Genomics 2021Quote: ... Cells were briefly stained with 4′,6-diamidino-2-phenylindole (DAPI) before using flow cytometry (BD FACS Aria ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were seeded onto collagen I-coated 6-well tissue culture plates (BD biosciences #346400) in packaging medium (DMEM (Thermo Fisher #11965) ...
-
bioRxiv - Molecular Biology 2022Quote: The following antibodies were used for immunofluorescence experiments: mouse anti-TIAR (Clone 6; 610352, BD Biosciences), rabbit anti-YTHDF2 (24744-1-AP ...
-
bioRxiv - Microbiology 2020Quote: ... 6 and 8 hours after infection by flow cytometry using a FACS Aria III (BD Biosciences). The intensity of GFP fluorescence corresponds to the amount of intracellular bacteria ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-α-6 integrin-PE (GoH3) and anti-CD117 (c-KIT)-APC (2B8) antibodies (BD Pharmingen). For purification of undifferentiated spermatogonia ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (2.5 ml) was added to 6-well plates (BD Biosciences Inc., Franklin Lakes, NJ), and allowed to solidify ...
-
bioRxiv - Genomics 2021Quote: ... and a PE-conjugated Mouse Anti-Human HLA-DR antibody (BD Biosciences 555812, clone G46-6). Data were analyzed in FlowJo (FlowJo LLC ...
-
bioRxiv - Biochemistry 2021Quote: ... or a complete LB+agar pre-mix (“LB Agar 3”; BD Difco, catalog # DF0445-07-6) and found that LB Agar 3 requires about ≈10x less of the additive lauryl LSB (≈0.1% ...
-
bioRxiv - Cancer Biology 2021Quote: ... or propidium iodide (PI) solution (eBioscience) and analyzed with a 6-Laser Fortessa cytometer (BD Biosciences). For accurate cell number quantification ...
-
bioRxiv - Immunology 2021Quote: ... The following kits were used to detect indicated cytokines: Mouse IL-6 Flex Set (BD, 558301), Mouse TNF Flex Set (BD ...
-
bioRxiv - Immunology 2021Quote: ... we used the following 14 antibodies::fluorophore conjugates and clones: HLA-DR::BUV395 (BD; G46-6), CD14::BUV737 (BD ...
-
bioRxiv - Microbiology 2021Quote: ... Serial dilutions were performed and plated on 1/6 Tryptic Soy medium (BD, Maryland, 21152. USA), solidified with 1.5% agar ...
-
bioRxiv - Immunology 2023Quote: ... and incubated overnight with a cocktail of intracellular antibodies – IL-6 (BD Biosciences, MQ2-6A3, FITC), TNFα (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: ... Bcl-6-PE (cat # 569522) and phosphor-STAT5-PE (pY694) (cat # 612567) were procured from BD Biosciences.
-
bioRxiv - Immunology 2019Quote: IL-10 secretion was determined using the mouse IL-10 ELISA set (BD Biosciences Inc) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% (v/v) FBS and 10% (v/v) tryptose phosphate broth (BD Biosciences).
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Immunology 2023Quote: ... IP-10 in tissue culture supernatants was quantified with a Human IP-10 ELISA Set (BD).
-
bioRxiv - Cell Biology 2019Quote: NHEM cells were trypsinized and seeded at density of 1X105cells/well in 6-well plate (BD Bioscience) and incubated overnight with antibiotic containing M254 (Thermofisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1×106 293FT cells were plated into 6-well plate coated with collagen I (BD Bioscience, #354236), transfection was performed with retroviral constructs together with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... The ELISA was then performed as per the manufacturer’s instructions (BD Bioscience IL-6 ELISA Cat. #555220), and concentrations determined by interpolating absorbance values of samples using a standard curve.
-
bioRxiv - Developmental Biology 2021Quote: ... non-adherent bone marrow cells were seeded in triplicate in 6-well collagen-coated plates (BD Biosciences) at a density of 1×105 cells/well ...
-
bioRxiv - Microbiology 2021Quote: ... P was analyzed (as molybdate reactive P) in the 6 extracts (referred to as H2O-P, BD-P ...
-
bioRxiv - Immunology 2020Quote: ... then stained with the antibodies described in Supplementary Table 6 and analysed on the LSRII (BD Bioscience). Data were analysed with the FlowJo v10.4.2 software (FlowJo LLC).
-
bioRxiv - Microbiology 2020Quote: ... and IFN-γ secreted by splenocytes of C57BL/6 mice were determined using ELISPOT kits (BD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Stained cells were analyzed using a BD LSRII Fortessa equipped with FACSDiva software (Version 6) (BD Pharmingen). Samples were acquired using Fortessa’s HTS plate reader option at an event rate below 20,000 events/s ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% (wt/vol) glucose (BD Difco), 2 μl/ml catalase (C100 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... EDTA-coated tubes (10 mL BD Vacutainer® tubes ...
-
bioRxiv - Immunology 2021Quote: ... FoxP3 and IL-10 from BD Bioscience and MHC II (I-A/I-E ...
-
bioRxiv - Cell Biology 2021Quote: ... CD36 (1/10, 555455, BD Pharmingen), PD-L1 (1/100 ...