Labshake search
Citations for Avidity :
1 - 50 of 135 citations for Recombinant Human LILRA5 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The Avi-tagged proteins were biotinylated using the BirA enzyme (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The Avi-tagged proteins were biotinylated using the BirA enzyme (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Avi-tagged proteins were biotinylated using the biotinylated by BirA enzymatic reaction (Avidity, Inc) according to the manufacturer’s protocol and purified by SEC ...
-
bioRxiv - Immunology 2021Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
-
bioRxiv - Immunology 2022Quote: ... The Protein A resin captured AVI-tagged ZM197-ZM233V1V2 was biotinylated with BirA enzyme (Avidity) and cleaved from the Fc purification tag with HRV3C protease ...
-
bioRxiv - Immunology 2023Quote: ... avi-tagged proteins were biotinylated with a BirA500 biotin-ligase reaction kit according to the manufacturer’s instruction (Avidity). TT was purchased from Creative Biolabs (Vcar-Lsx003) ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Immunology 2020Quote: ... Avi-tagged HAs were expressed and purified as described above and biotinylated using the Biotin ligase kit (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... S proteins with Avi-tag were pre-biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity). 25 nM S-614D or 15 nM S-614G in 10X kinetic buffer (ForteBio ...
-
bioRxiv - Bioengineering 2021Quote: ... S1 protein was biotinylated at the AVI-tag using the BirA biotin-protein ligase kit (Avidity Biosciences) and premixed at 5 nM with serial dilutions of VNAR-hFc antibodies for 1 hr at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... and subsequently biotinylated at the C-termini Avi tag sequence via BirA biotin-protein ligase (Avidity) (31) ...
-
bioRxiv - Immunology 2023Quote: ... GP was biotinylated by the Avi tag (Avidity, Aurora, Colorado) and exchanged into PBS 7.4.
-
bioRxiv - Immunology 2020Quote: All antigens with an Avi tag were biotinylated enzymatically using BirA biotin-protein ligase (Avidity, Bulk BirA) while non-Avi tagged antigens were biotinylated chemically using EZ-Link Sulfo-NHS-Biotin (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... BG505.SOSIP.664.Avi was biotinylated using the BirA-Ligase (Avidity) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Purified proteins with an avi-tag were biotinylated by using BirA following the BirA500 kit’s protocol (Avidity, BirA500). Biotinylation was confirmed by performing a Coomassie gel shift assay according to Fairhead and Howarth ...
-
bioRxiv - Immunology 2021Quote: ... The captured SARS-CoV-2 protein was then biotinylated using the BIRA500 kit (∼2.5 μg per 10 nmol AVI substrate) (Avidity) and cleaved from the Fc purification tag concurrently with 200 μg of HRV3C prepared as described [42] ...
-
bioRxiv - Immunology 2021Quote: ... C-terminal Histidine/Avi-tagged) was obtained from BEI resources (Manassas, VA, USA, Cat. NR53524) and biotinylated using a BirA ubiquitin ligase (Avidity, Aurora, CO, USA, Cat. Bir500A) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2023Quote: Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: Recombinant HA trimers were biotinylated by addition of biotin–protein ligase (Avidity). To generate HA tetramers ...
-
bioRxiv - Immunology 2023Quote: BSP-tagged proteins were biotinylated using the BirA biotin-ligase bulk reaction kit (Avidity), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The avi-tagged SARS-CoV-2 RBD antigen was first labeled with biotin (Avidity, BirA500) was subsequently coupled to streptavidin-PE and streptavidin-APC (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... C-terminally Avi-tagged RBDs were modified with site-specific biotinylation (Avidity, LLC, Aurora, CO) according to the manufacturer’s protocol and immobilized on streptavidin-coated beads (Berkeley Lights ...
-
bioRxiv - Biophysics 2022Quote: The GPIbα used for kinetic measurements contained an N-terminal Avi-tag which was biotinylated using a BirA biotin-protein ligase kit (Cat #BirA500, Avidity, Aurora, CO). Biolayer interferometry (BLI ...
-
bioRxiv - Immunology 2021Quote: ... the probes were generated by the biotinylation of Avi-tagged SARS-CoV-2 antigens using biotin ligase BirA according to the manufacturer’s instructions (Avidity). Biotin excess was removed by SEC on either a Superdex 200 10/300 column (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 NTD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (Robbiani et al. ...
-
bioRxiv - Immunology 2021Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before 1 ...
-
bioRxiv - Immunology 2020Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... soluble avidin-tagged Gamma S protein was biotinylated with a BIrA500 biotin-ligase reaction kit according to the manufacturer’s instruction (Avidity). Biotinylated protein was then mixed with streptavidin fluorophores (AF647 ...
-
bioRxiv - Immunology 2021Quote: ... trimers used as baits in flow cytometry were expressed with a C-term Avi-tag and biotinylated using a BirA biotinylation kit according to manufacturer’s instructions (Avidity). The BG505 MD39-base KO trimer had the following mutations relative to the BG505 MD39 SOSIP ...
-
bioRxiv - Microbiology 2019Quote: ... E2mc3 was generated by biotinylation of the individual Avi-tagged HCV E2mc3 using biotin ligase BirA according to the manufacturer’s instructions (Avidity LLC). Biotin excess was removed by SEC on a Superdex 200 column (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... with N-terminal MRGS(H)8 and C-terminal Avi tag was biotinylated in vivo by co-expressing biotin-ligase BirA (pBirAcm from Avidity) in E.coli BL21 (DE3) ...
-
bioRxiv - Immunology 2021Quote: Constructs containing an Avi-tag (ZM197 Env and HA NC99) were biotinylated using the site-specific biotinylation kit according to manufacturer instructions (Avidity LLC.) All other antigens not containing an Avi-tag were non-specifically biotinylated using the EZ-Link Sulfo-NHS-Biotin kit at a 50:1 biotin:protein molar ratio.
-
bioRxiv - Synthetic Biology 2023Quote: Proteins with Avi-tags (GLNDIFEAQKIEWHE; see supplementary materials) were purified as described above and biotinylated in vitro using the BirA500 (Avidity, LLC) biotinylation kit ...
-
bioRxiv - Immunology 2023Quote: ... rhesus macaque FcγR2A and FcγR3A (acquired from the Duke Human Vaccine Institute Protein Production Facility) were biotinylated with a BirA biotin–protein ligase bulk reaction kit (Avidity). C1Q (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... pET11a[LacR-Avi] and pBirAcm (Avidity) vectors were transformed into T7 Express competent cells ...
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare) ...
-
bioRxiv - Immunology 2023Quote: ... Env trimers with C-terminal avi-tags (Avidity) were biotinylated and conjugated to streptavidin labeled with different fluorochormes ...
-
bioRxiv - Immunology 2020Quote: S protein was biotinylated using Bir-A (Avidity) and labelled by the sequential addition of streptavidin (SA ...
-
bioRxiv - Biophysics 2022Quote: ... with biotinylated/unbiotinulated MBP-AviTagTM fusion protein (Avidity) as controls.
-
bioRxiv - Biophysics 2022Quote: ... coli.19 The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare).
-
bioRxiv - Molecular Biology 2021Quote: ... Two complimentary oligonucleotides corresponding to the Avi-tag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA incorporating Hindlll overlapping ends were synthesized (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2021Quote: ... and HA proteins were biotinylated using AviTag technology (Avidity) according to published protocols (51 ...
-
bioRxiv - Immunology 2024Quote: ... Protein was biotinylated using the BirA enzyme (Avidity, USA) and purified via size-exclusion chromatography (Superdex S75 column ...
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity, #BirA500). Biotinylation of the NiV protein probes was confirmed by biolayer interferometry by testing the ability of the biotinylated protein to bind to streptavidin sensors ...
-
bioRxiv - Immunology 2020Quote: ... purified PR8-HA and S proteins were biotinylated using BirA biotin-protein ligase (Avidity). Biotinylated PR8-HA and S proteins were fluorescently labelled by the sequential addition of streptavidin-conjugated to phycoerythrin (PE ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...