Labshake search
Citations for Cell Biolabs :
1 - 50 of 161 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... The AAV-HSA-GFP plasmid was developed by inserting a human HSA promoter and GFP (ZsGreen1) into the promoterless AAV vector (Cell BioLabs, Cat. No. VPK-411-DJ) using In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Biophysics 2024Quote: ... The calibration curve was determined using pure eGFP (Cell Biolabs, STA-201) following a procedure described earlier26.
-
bioRxiv - Neuroscience 2022Quote: ... The viral vector was constructed using GFP [pAAV-U6-GFP (provided by Cell Biolabs)] with the shRNA sequence against AADC mRNA (shAADC ...
-
bioRxiv - Cell Biology 2021Quote: ... Fixed cells were stained with the Cellular Senescence Detection Kit (CBA-230, Cell Biolabs, CA, USA) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... 2017) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
bioRxiv - Neuroscience 2019Quote: ... cassettes targeting murine Kv4.1 sequence (GCTGCCTTCTGGTATACCATT) or containing a non-targeting control sequence (TCGCATAGCGTATGCCGTT) were cloned under mU6 promoter of pAAV-U6-GFP vector (Cell Biolabs). AAV particles were produced in HEK 293T cells by co-transfecting pAAV-RC ...
-
bioRxiv - Neuroscience 2020Quote: ... and cloning oligonucleotides targeting mouse Iqsec3 (5’-GAA CTG GTG GTA GGC ATC TAT GAG A-3’) into the BamHI and EcoRI sites of the pAAV-U6-GFP vector (Cell BioLabs, Inc.) or AvrII and EcoRI sites of the pAAV-Ef1α-DSE-mCherry-PSE vector (Addgene) ...
-
bioRxiv - Biochemistry 2019Quote: ... and the sense guides (sgRNA1) into the puromycin-selectable pBABED P U6 plasmid (Dundee-modified version of the original Cell Biolabs pBABE plasmid, DU48788). Cells at about 80% confluency were co-transfected in 10-cm dishes with 2 µg each of the sgRNA plasmid pairs and 20 µl of PEI stock solution (1 mg/ml) ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting the open reading frame of mouse Tenascin-R into adeno-associated viral (AAV) vector U6 GFP (Cell Biolabs Inc., San Diego, CA 92126, USA), using BamH1 and EcoR1 restriction sites (Okuda et al ...
-
bioRxiv - Neuroscience 2023Quote: ... shown to be effective against Ncan mRNA (Okuda et al., 2014) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
bioRxiv - Neuroscience 2019Quote: ... were generated by the insertion of three different siRNA sequences (obtained from Dharmacon, Horizon Discovery, supplementary table 1) into AAV U6 GFP (CELL BIOLABS INC., San Diego, CA 92126, USA) using BamH1 and EcoR1 restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... The levels of S protein in different brain regions upon its intranasal infusion were measured using His-Tag protein ELISA kit that allows detection and quantification of poly-histidine-tagged proteins in a biological sample (Cell Biolabs Inc., CA, USA). The experimental procedure was performed as recommended by the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... Each variant was pooled and the titer of the virus was determined by quantitative PCR relative to a standard curve using ITR-binding primers or by using a QuickTiter AAV Quantitation Kit (Cell Biolabs). The relative titer of each variant in the pooled AAV library was confirmed by Illumina MiSeq sequencing (primer sequences are provided in Table S1).
-
bioRxiv - Immunology 2020Quote: Adenosine Assay Kit (Cell Biolabs Inc.);
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The Cell Contraction Assay kit (Cell Biolabs) was used for gel contraction (39) ...
-
bioRxiv - Cancer Biology 2023Quote: ... a Taurine Assay Kit (Cell Biolabs, Inc.) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... and AP Sites Quantitation Kit (Cell Biolabs), respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... The mouse Mafa coding sequence was amplified by PCR and subcloned into pAAV-MCS (VPK-410, Cell Biolabs. Inc.).
-
bioRxiv - Neuroscience 2019Quote: ... The PCR product was cloned into BamHI and XhoI sites of pMXs-IRES-Bsd retroviral expression vector (Cell Biolabs, Inc.). The primer sequences were 5’-AAAA AGGATCCACTTAAGCTTGGTACCAC-3’ and 5’-TCTAGACTCGAGTTAATATCTGCT AGACA-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used as a template to amplify the MPI gene by PCR using a primer set (Supplementary Table S1) and the PCR products were cloned into pMXs-Neo retroviral expression vector (RTV-011, Cell Biolabs) to yield pMXs-Neo-hMPI by using In-Fusion HD Cloning Kit (639648 ...
-
bioRxiv - Genomics 2020Quote: The Radius Cell Migration Assay kit (Cell Biolabs, Inc) was used for the gap closure assay ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ...
-
bioRxiv - Genetics 2022Quote: ... nuclear and cytosolic fractionation kit (Cell Biolabs: AKR-171) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... the 96-Well Cellular Senescence Assay Kit (Cell Biolabs) was used ...
-
bioRxiv - Biochemistry 2022Quote: ... The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011, Cell Biolabs, Inc.). pGL3-basic-MafA plasmid (−10427/+22 from transcription start site ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... was evaluated using OxiSelect™ TAC Assay Kit (Cell Biolabs, Inc. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Serum free fatty acids were measured using kits from Cell Biolabs, Inc (San Diego ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we used a GFP ELISA Kit (AKR-121, Cell Biolabs Inc.) which can detect GFP ...
-
bioRxiv - Biophysics 2020Quote: LDH leakage assay (CytoSelect LDH cytotoxicity assay kit, CBA-241, Cell Biolabs) was performed to assess the membrane integrity of the cells grown on the substrates ...
-
bioRxiv - Cancer Biology 2020Quote: ... and titer was calculated using QuickTiter lentivirus Titer Kit (Cell Biolabs, Inc.). Virus was added to MIA PaCa-2 and PANC-1 cells with 10ug/ml polybrene at a MOI of 0.3 and selected with puromycin (3μg/ml ...
-
bioRxiv - Biophysics 2022Quote: Lipid concentrations were determined with a Lipid Quantification Kit (Cell Biolabs, Inc). 15 µl of analyte or of a DOPC standard were added to 150 µl of 18 M H2SO4 and successively incubated at 90°C for 10’ and at 4 °C for 5’ ...
-
bioRxiv - Bioengineering 2023Quote: ... and QuickTiter™ Adenovirus Titer ELISA Kit (Cell Biolabs, San Diego, CA), respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... AP sites were quantified using AP sites quantification kit (Cell Biolabs, Inc.) according to the manufacturers instructions ...
-
bioRxiv - Immunology 2021Quote: ... The adenosine concentrations were determined using the Adenosine Assay Kit (Cell BioLabs, Inc.) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: The OxiSelect Superoxide Dismutase Activity Assay kit (Cell Biolabs, San Diego, CA, USA) was used to quantify SOD activity ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: HDL was isolated from mouse plasma using HDL Purification Kit (Cell BioLabs, Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Lentiviral titer was determined using the Lentivirus-Associated p24 ELISA Kit (Cell biolabs) following suppliers instructions.
-
bioRxiv - Neuroscience 2021Quote: ... We used HNE-His ELISA Kit (Cell BioLabs, Inc., San Diego, CA, USA) as described in Kandimalla et al 2016 ...
-
bioRxiv - Microbiology 2021Quote: ... Alanine concentrations were determined enzymatically using the Alanine Assay Kit (Cell Biolabs, Inc.) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2022Quote: ... and 14 with a fluorometric glucose assay kit (Cell Biolabs Inc, California, USA). An MGO assay (methylglyoxal assay kit ...
-
bioRxiv - Cancer Biology 2022Quote: Cell adhesion assays were performed using ECM cell adhesion array kit (Cell Biolabs, Inc. ...
-
bioRxiv - Immunology 2023Quote: ... Virus was titered using the QuickTiter™ Lentivirus Titer Kit (Cell Biolabs, Inc) following manufacturer conditions.
-
bioRxiv - Microbiology 2023Quote: Protein carbonyls were visualized using the OxiSelect Protein Carbonyl Immunoblot Kit (Cell Biolabs). Tnrf1-/- BMDMs were seeded in 24-well plates at 2.5x105 one day prior to infection with indicated L ...
-
bioRxiv - Microbiology 2023Quote: Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Protein carbonylation was measured using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAV6 titre was determined by Quick Titre AAV quantification kit (Cell BioLabs, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... a COMET assay was performed using the Oxiselect Comet Assay Kit from Cell Biolabs, Inc ...
-
bioRxiv - Developmental Biology 2022Quote: Collagen analysis was performed using the CytoSelect Cell Contraction Assay Kit (Cell Biolabs, Inc). Mitral valves were dissected from control and mutant hearts at E18.5 and were digested with 1mg/ml collagenase and dispase (Sigma-Aldrich ...
-
Repeated phenotypic selection for cuticular blackness of armyworm larvae decreased stress resistancebioRxiv - Physiology 2019Quote: ... using an OxiSelect™In Vitro ROS/RNS Assay kit (Cell Biolabs, Inc., USA) (Cohen et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Senescence of ECs was measured using the Cellular Senescence Assay kit from Cell Biolabs, Inc ...