Labshake search
Citations for Cell Biolabs :
51 - 100 of 165 citations for Rat Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Adenosine Assay Kit (Cell Biolabs Inc.);
-
bioRxiv - Neuroscience 2019Quote: ... cassettes targeting murine Kv4.1 sequence (GCTGCCTTCTGGTATACCATT) or containing a non-targeting control sequence (TCGCATAGCGTATGCCGTT) were cloned under mU6 promoter of pAAV-U6-GFP vector (Cell Biolabs). AAV particles were produced in HEK 293T cells by co-transfecting pAAV-RC ...
-
bioRxiv - Immunology 2023Quote: Homology donors comprising sequences to be inserted and flanking homology arms were cloned into plasmid ITR-CMV-GFP (containing ITRs from AAV2; Cell Biolabs) or pVAX by Infusion cloning (Takara) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The Cell Contraction Assay kit (Cell Biolabs) was used for gel contraction (39) ...
-
bioRxiv - Cancer Biology 2023Quote: ... a Taurine Assay Kit (Cell Biolabs, Inc.) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... and AP Sites Quantitation Kit (Cell Biolabs), respectively ...
-
bioRxiv - Physiology 2022Quote: ... muscle samples were bead homogenized by a Qiagen Tissuelyser in reducing sample buffer (Tris-HCl, pH 6.8; 2% SDS; 10% glycerol; 1% β-mercaptoethanol) containing protease inhibitors (Cell Biolabs, AKR-190). Samples were centrifuged at 10,000 rpm at 4 °C ...
-
bioRxiv - Immunology 2022Quote: The migratory potential of monocytes to supernatants containing chemokines was measured using the CytoSelect 96-well Cell Migration Assay Cell Migration assay (Cell Biolabs, San Diego CA). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 ×104 cells were seeded into 24-well plates containing CytoSelect™ 24-Well Wound Healing Assay inserts (Cell Biolabs, San Diego, CA, USA) (16) ...
-
bioRxiv - Genomics 2020Quote: The Radius Cell Migration Assay kit (Cell Biolabs, Inc) was used for the gap closure assay ...
-
bioRxiv - Genetics 2022Quote: ... nuclear and cytosolic fractionation kit (Cell Biolabs: AKR-171) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... the 96-Well Cellular Senescence Assay Kit (Cell Biolabs) was used ...
-
bioRxiv - Genomics 2019Quote: ... for 120 min at 37 °C and measured by the Boyden chamber method with a 96-well micro-chemotaxis chamber containing a 3-µm pore-sized filter (CELL BIOLABS, INC., San Diego, CA, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... was evaluated using OxiSelect™ TAC Assay Kit (Cell Biolabs, Inc. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Serum free fatty acids were measured using kits from Cell Biolabs, Inc (San Diego ...
-
bioRxiv - Biophysics 2020Quote: LDH leakage assay (CytoSelect LDH cytotoxicity assay kit, CBA-241, Cell Biolabs) was performed to assess the membrane integrity of the cells grown on the substrates ...
-
bioRxiv - Cancer Biology 2020Quote: ... and titer was calculated using QuickTiter lentivirus Titer Kit (Cell Biolabs, Inc.). Virus was added to MIA PaCa-2 and PANC-1 cells with 10ug/ml polybrene at a MOI of 0.3 and selected with puromycin (3μg/ml ...
-
bioRxiv - Biophysics 2022Quote: Lipid concentrations were determined with a Lipid Quantification Kit (Cell Biolabs, Inc). 15 µl of analyte or of a DOPC standard were added to 150 µl of 18 M H2SO4 and successively incubated at 90°C for 10’ and at 4 °C for 5’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... AP sites were quantified using AP sites quantification kit (Cell Biolabs, Inc.) according to the manufacturers instructions ...
-
bioRxiv - Immunology 2021Quote: ... The adenosine concentrations were determined using the Adenosine Assay Kit (Cell BioLabs, Inc.) following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: The OxiSelect Superoxide Dismutase Activity Assay kit (Cell Biolabs, San Diego, CA, USA) was used to quantify SOD activity ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: HDL was isolated from mouse plasma using HDL Purification Kit (Cell BioLabs, Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Alanine concentrations were determined enzymatically using the Alanine Assay Kit (Cell Biolabs, Inc.) following the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2022Quote: ... and 14 with a fluorometric glucose assay kit (Cell Biolabs Inc, California, USA). An MGO assay (methylglyoxal assay kit ...
-
bioRxiv - Cancer Biology 2022Quote: Cell adhesion assays were performed using ECM cell adhesion array kit (Cell Biolabs, Inc. ...
-
bioRxiv - Immunology 2023Quote: ... Virus was titered using the QuickTiter™ Lentivirus Titer Kit (Cell Biolabs, Inc) following manufacturer conditions.
-
bioRxiv - Microbiology 2023Quote: Protein carbonyls were visualized using the OxiSelect Protein Carbonyl Immunoblot Kit (Cell Biolabs). Tnrf1-/- BMDMs were seeded in 24-well plates at 2.5x105 one day prior to infection with indicated L ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAV6 titre was determined by Quick Titre AAV quantification kit (Cell BioLabs, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... a COMET assay was performed using the Oxiselect Comet Assay Kit from Cell Biolabs, Inc ...
-
bioRxiv - Developmental Biology 2022Quote: Collagen analysis was performed using the CytoSelect Cell Contraction Assay Kit (Cell Biolabs, Inc). Mitral valves were dissected from control and mutant hearts at E18.5 and were digested with 1mg/ml collagenase and dispase (Sigma-Aldrich ...
-
Repeated phenotypic selection for cuticular blackness of armyworm larvae decreased stress resistancebioRxiv - Physiology 2019Quote: ... using an OxiSelect™In Vitro ROS/RNS Assay kit (Cell Biolabs, Inc., USA) (Cohen et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Senescence of ECs was measured using the Cellular Senescence Assay kit from Cell Biolabs, Inc ...
-
bioRxiv - Biochemistry 2019Quote: The OxiSelect In Vitro ROS/RNS Assay Kit (Cell Biolabs, San Diego, CA, USA) was used to quantify reactive species (ROS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... HDL and LDL were prepared from serum by Lipoprotein Purification Kits (Cell BioLabs, Inc.). Sandwich ELISA was used to measure plasma MDA-LDL and MDA-HDL levels following the manufacturer’s instructions (Cell BioLabs ...
-
bioRxiv - Biochemistry 2021Quote: ... respectively. QuickTiter Lentivirus Titer kit (Cat. No. VPK-107) was purchased from Cell Biolabs Inc (San Diego ...
-
bioRxiv - Biochemistry 2020Quote: ... and adenovirus was concentrated by ViraBind™ adenovirus purification kit (Cell Biolabs, VPK-100). Adenovirus titer was measured by counting GFP-positive cells 24 h after infection with serial dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Additional kits and reagents used included: hydrogen sulfide gas assay (ZAN-5084, Cell Biolabs), fluorescein isothiocyanate-dextran (FITC-dextran ...
-
bioRxiv - Cancer Biology 2019Quote: ... a CytoSelect 96-well cell transformation assay kit (Cell Biolabs Inc., San Diego, CA) was used according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... HDL and LDL were prepared from serum by Lipoprotein Purification Kits (Cell BioLabs, Inc.).
-
bioRxiv - Cancer Biology 2024Quote: ... comet assays were performed using the Oxiselect Comet Assay Kit (Cell Biolabs #STA-355) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ROS were measured using the OxiSelect In Vitro ROS/RNS Assay Kit (Cell Biolabs, Inc.) per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... It was performed according to the instructions of the OxiSelect Comet Assay Kit (Cell Biolabs). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... Viral particles were purified using Virabind AAV Purification Kit (Cell Biolabs, Inc., cat# VPK-140). AAV titers were approximately 1.0 ×1011 infectious units/ml ...
-
bioRxiv - Cancer Biology 2023Quote: S-adenosyl-methionine (SAM) was measured with a kit from Cell Biolabs (Cat MET-5152). Briefly ...
-
bioRxiv - Biophysics 2023Quote: Cell viability was monitored using a MTT Cell Proliferation Assay Kit (Cell BioLabs, #CBS-252). HEK 293T cells ...
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining cells were used for nuclear extraction using the Nuclear/Cytosolic Fractionation Kit (Cell Biolabs) following the manual ...
-
bioRxiv - Cancer Biology 2021Quote: Free radical ROS/RNS was measured using OxiSelect in vitro ROS/RNS assay kit (Cell Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Fixed cells were stained with the Cellular Senescence Detection Kit (CBA-230, Cell Biolabs, CA, USA) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2021Quote: ... cellular HBcAg was analyzed using a commercial kit (Cell Biolabs Inc, San Diego, CA, Cat# VPK150), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Virus titer was measured using the QuickTiter™ Lentivirus Titer Kit (Cell Biolabs, VPK-107-T) according to the manufacturer’s instructions.