Labshake search
Citations for Cell Biolabs :
401 - 450 of 495 citations for Dengue Virus Serotype 4 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: The firefly luciferase cDNA was cloned into the PSMPUW-Hygro lentiviral vector (Cell Biolabs, catalog number: VPK-214). Lentiviruses containing the luciferase expression cassette were produced in 293 TN cells (System Bioscience ...
-
bioRxiv - Immunology 2023Quote: Intracellular NO levels were measured using OxiSelect Intracellular Nitric Oxide (NO) Assay Kit (Cell Biolabs, STA-800-5). Nitrite levels in the cleared supernatant were measured using Griess Reagent Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: 70-150mg of tumor pieces were chopped into small pieces in RIPA buffer containing proteinase inhibitor (Cell BioLabs) and homogenized using OctoMACS (Miltenyi Biotec) ...
-
bioRxiv - Cell Biology 2019Quote: Total PA content was measured with a coupled enzymatic reaction assay (Total Phosphatidic Acid Assay Kit, Cell Biolabs, Inc.). Briefly ...
-
bioRxiv - Bioengineering 2021Quote: ... The number of lentiviral particles were quantified using the QuikTiter Lentivirus Quantitation Kit from Cell Biolabs (HIV P24 ELISA). All reported viral titers were within the linear range of the standard curve made using a positive control ...
-
bioRxiv - Biochemistry 2020Quote: ... (for Fig. 4B and C and Fig. 5B) commercially available kit was used for Tyr quantification (Cell Biolabs - Biocat).
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-RC-DJ (AAV2/DJ) and pAAV-MCS/pAAV-Helper were purchased from Cell Biolabs (San Diego, CA, USA) and Agilent Technologies (Santa Clara ...
-
bioRxiv - Cancer Biology 2020Quote: Alkalin Comet assays were performed with OxiSelect Comet Assay Kit and according to the manufacturer’s instructions (Cell Biolabs Inc.). Electrophoresis was performed at 4°C in alkaline condition at 20V during 45mn ...
-
bioRxiv - Microbiology 2021Quote: ... grown in 10 cm dish were transiently transfected with the following plasmids: 5 µg of pLenti-GFP (Cell Biolabs), 6 µg of psPAX2 and 0.9 µg of pCMV-VSVG (Cell Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... The mouse Mafa coding sequence was amplified by PCR and subcloned into pAAV-MCS (VPK-410, Cell Biolabs. Inc.).
-
bioRxiv - Cell Biology 2022Quote: The hydroxyproline content of tissue was measured following the protocol from the hydroxyproline assay kit (Cell Biolabs Inc., CA). Briefly ...
-
bioRxiv - Genetics 2020Quote: ... and glucose (#STA-681) in mouse plasma were determined using the appropriate kit (all purchased from Cell Biolabs, Inc). Hearts and whole aortas (from the aortic arch to the iliac artery ...
-
bioRxiv - Neuroscience 2020Quote: ... according to the manufacturer’s protocol (AAV purification kit, reference 6666 from Takara and reference VPK-140 from Cell Biolabs). AAV particles were resuspended in PBS with an approximate titer of 1 x 1014 genome copies/ml ...
-
bioRxiv - Neuroscience 2024Quote: DNA damage in cellular nucleus was measured using an OxiSelect Comet Assay Kit (Cell Biolabs, San Diego, CA, USA).
-
bioRxiv - Neuroscience 2020Quote: ... EV effects on neuronal membrane integrity were assessed using the ethidium homodimer (EthD-1) assay (Cell Biolabs, San Diego, CA), which is based on the detection of the membrane impermeable EthD-1 dye which fluoresces when bound to DNA ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Sandwich ELISA was used to measure plasma MDA-LDL and MDA-HDL levels following the manufacturer’s instructions (Cell BioLabs, Inc.). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... The <ι>β-galactosidase activity was measured with the 96-Well Cellular Senescence Assay Kit (Cell Biolabs CBA-231) following the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Physiology 2021Quote: ... We assayed plasma 8-hydroxy-2’-deoxyguanosine (8-OHdG) levels (OxiSelect™ Oxidative DNA Damage Elisa kit, Cell Biolabs Inc.) and insuline-like growth-factor 1 (IGF-1 ...
-
bioRxiv - Immunology 2020Quote: Intracellular NO levels were quantified using an OxiSelect™ Intracellular Nitric Oxide (NO) Assay Kit (Cell Biolabs cat. STA-800). Primary mouse keratinocytes were incubated with medium containing Nitric Oxide Fluorometric Probe at a 1:1000 dilution at 37℃ for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CDC42 were performed using Small GTPase Activation Kits according to the manufacturer’s protocol (Cell Biolabs; STA-401, 402, 403). Briefly ...
-
bioRxiv - Neuroscience 2019Quote: ... The PCR product was cloned into BamHI and XhoI sites of pMXs-IRES-Bsd retroviral expression vector (Cell Biolabs, Inc.). The primer sequences were 5’-AAAA AGGATCCACTTAAGCTTGGTACCAC-3’ and 5’-TCTAGACTCGAGTTAATATCTGCT AGACA-3’ ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Fresh HDL was purified from FH patients and normal subjects following the HDL purification kit’s instructions (Cell Biolabs Inc., California). Maloncarbonyl bis- (dimethylacetal) ...
-
bioRxiv - Cell Biology 2023Quote: ... a fluorometric cellular senescence assay kit was used according to the manufacturer’s protocol (Cell biolabs Inc., San Diego, CA, USA). In short ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were then blocked for 1 hour at room temperature in blocking buffer containing 5% PhosphoBLOCKER blocking reagent (Cell Biolabs) in TBST ...
-
bioRxiv - Neuroscience 2023Quote: ... The level of ROS was detected by the OxiSelect™ Green Fluorescence In Vitro ROS/RNS Assay Kit (CELL BIOLABS) according to manufacturer’s protocol ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: ... Post treatment the β-galactosidase activity was measured by using the β-galactosidase staining kit (AKR-100 Cell Biolabs Inc). Brightfield images of the stained cells were taken using colour camera.
-
bioRxiv - Neuroscience 2023Quote: ELISA assays for GFP-tagged GABAARα subunit expression in the muscle and spinal cord were performed per the manufacturer’s instructions (GFP ELISA Kit, Cell Biolabs). Larvae were anaesthetized in 0.02% tricaine methanesulphonate (10 g/L stock solution ...
-
bioRxiv - Physiology 2023Quote: TAG and total cholesterol evaluation were processed according to the manufacturer’s instructions (Sigma-Aldrich, MAK266 for TAG and Cell Biolabs, San Diego ...
-
bioRxiv - Neuroscience 2024Quote: ... 2017) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
bioRxiv - Immunology 2019Quote: LDL/VLDL was isolated from 2-3ml pooled healthy male or female serum using LDL/VLDL Purification Kit (Ultracentrifugation Free) (CELL BIOLABS) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Concentrations of MLV p30 in the supernatants were determined using QuickTiter™ MuLV Core Antigen ELISA Kit (MuLV p30; Cell Biolabs). DNA was isolated from the infected cells using the DNeasy Blood and Tissue Kit (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: The HA-tagged mouse Bhlhe40 coding sequence was excised from a pCAGGS-DEC1 plasmid (RDB08473, Riken, Saitama, Japan; ref. 52) and subcloned into pcDNA3.1 and pMXs-Puro Retroviral vector (RTV-012, Cell Biolabs, Inc.). For knockdown experiments ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The 8-OHdG levels in urine collected from 7-week-old mice were measured once for each sample by using the 8-OHdG DNA Damage ELISA kit manufactured by Cell Biolabs, Inc ...
-
bioRxiv - Synthetic Biology 2019Quote: ... AAV6-CCR5-PGK-GFP was produced at Sangamo Therapeutics as previously described.5 All other AAV vectors were produced in-house using the AAV helper free packaging system (Cell Biolabs). Briefly ...
-
bioRxiv - Neuroscience 2019Quote: ... cassettes targeting murine Kv4.1 sequence (GCTGCCTTCTGGTATACCATT) or containing a non-targeting control sequence (TCGCATAGCGTATGCCGTT) were cloned under mU6 promoter of pAAV-U6-GFP vector (Cell Biolabs). AAV particles were produced in HEK 293T cells by co-transfecting pAAV-RC ...
-
bioRxiv - Cell Biology 2021Quote: ... The STING-GFP coding sequence was then cut from the pEGFP-N1 backbone and ligated into a pMXs-IRES-Blasticidin Retroviral Vector backbone (RTV-016, Cell Biolabs) using XhoI and SacII restriction sites ...
-
bioRxiv - Bioengineering 2021Quote: ... Each variant was pooled and the titer of the virus was determined by quantitative PCR relative to a standard curve using ITR-binding primers or by using a QuickTiter AAV Quantitation Kit (Cell Biolabs). The relative titer of each variant in the pooled AAV library was confirmed by Illumina MiSeq sequencing (primer sequences are provided in Table S1).
-
bioRxiv - Cell Biology 2021Quote: ... Samples were stored at −80°C and analyzed by the Total Cholesterol Assay Kit (INC, cat. no. STA-384; Cell Biolabs).
-
bioRxiv - Cancer Biology 2022Quote: ... was used as a template to amplify the MPI gene by PCR using a primer set (Supplementary Table S1) and the PCR products were cloned into pMXs-Neo retroviral expression vector (RTV-011, Cell Biolabs) to yield pMXs-Neo-hMPI by using In-Fusion HD Cloning Kit (639648 ...
-
bioRxiv - Molecular Biology 2023Quote: The pri-miR-132 and pri-miR-124 expressing constructs were made by amplifying the pri-miRNA fragments (Supplementary table 1) from miRNASelectTM pEGP-mmu-mirna expression vectors (Cell Biolabs) and subsequently cloning them into the BamHI-BsrGI sites of pRRLSIN.cPPT.SYN.WPRE.
-
bioRxiv - Immunology 2023Quote: Homology donors comprising sequences to be inserted and flanking homology arms were cloned into plasmid ITR-CMV-GFP (containing ITRs from AAV2; Cell Biolabs) or pVAX by Infusion cloning (Takara) ...
-
bioRxiv - Biochemistry 2023Quote: ... were seeded into 10 cm2 plates and transfected at 90% confluency with 20 µg plasmid DNA and 10 µg helper plasmid (pCMV-Gag-Pol, Cell Biolabs) using CalPhos Mammalian Transfection Kit (Clontech®/Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... For the BCAA levels measured using the Branched Chain Amino Acid Assay Kit (Cell Biolabs, Inc. San Diego, CA, #MET-5056), tissue homogenates were prepared in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell extract was cleared by centrifugation and assayed for ROS/RNS accumulation by fluorescence-based approach using OxiSelect in vitro ROS/RNS Assay Kit (Cell Biolabs), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... An OxiSelect UV-Induced DNA Damage ELISA Combo Kit was utilized to determine the concentration of pyrimidine dimers in each sample well (Cell Biolabs Inc). Plates were read with a Biotek Conquer ELX800 plate reader (Biotek Inc).
-
bioRxiv - Cell Biology 2020Quote: Levels of cellular SA-β-Gal were determined using the 96-well Quantitative Cellular Senescence Assay kit (Cell Biolabs Inc; CA, USA), using a modified version of the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... ROS levels were determined using an OxiSelect in vitro ROS/RNS assay kit (STA-347; Cell Biolabs, Inc., San Diego, CA, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... the U6-VDAC1-shRNA sequences were then cut using ApaI and BstEI to be cloned into a pAAV-CMV-GFP vector (Cell Biolabs, Inc.), the pAAV-mito-GCaMP2 ...
-
bioRxiv - Neuroscience 2020Quote: ... and cloning oligonucleotides targeting mouse Iqsec3 (5’-GAA CTG GTG GTA GGC ATC TAT GAG A-3’) into the BamHI and EcoRI sites of the pAAV-U6-GFP vector (Cell BioLabs, Inc.) or AvrII and EcoRI sites of the pAAV-Ef1α-DSE-mCherry-PSE vector (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... AAV transgenes were packaged using an AAV helper-free packaging system (catalogue no. VPK-400-DJ; Cell Biolabs, San Diego, CA, USA) except for the plasmid carrying AAV rep and cap genes ...