Labshake search
Citations for Cell Biolabs :
51 - 100 of 528 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... the cells were assayed for alkaline phosphatase (AP) expression using StemTAG Alkaline Phosphatase staining kit (Cell Biolabs CBA-300). AP+ stained cells were imaged in 6-well plates using a M7000 Imaging System (Zeiss ...
-
bioRxiv - Cell Biology 2024Quote: Total phosphatidic acid was measured with an assay kit purchased from Cell Biolabs, Inc ...
-
bioRxiv - Genomics 2024Quote: ... we centrifuged them at 2000g for 15 minutes and fecal or hepatic bile acid concentrations in the collected supernatant was measured using a commercial colorimetric total bile acid assay kit (Cell Biolabs # STA-631) as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: PlatE cells (Cell BioLabs RV-101) were used for transfection and retroviral production of sgRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Pantropic ViraSafeTM Universal Lentiviral Expression System (Cell Biolabs, Inc.; VPK-211-PAN) was used to establish cells overexpressing the human ATP5IF1 and the Cox8aMTS:zsGreen1 ...
-
bioRxiv - Bioengineering 2024Quote: ... The stable EGFP expression HeLa cell line (HeLa-EGFP) was purchased from Cell Biolabs Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... The genetic construct was cloned into the EcoRI site of the pAAV-MCS (Cell Biolabs, catalog VPK-410) plasmid using In-Fusion cloning (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The OxiSelect Comet Assay Kit (Cell Biolabs) was used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Virus was produced using Helper Free Expression System and the 293AAV cell line (Cell Biolabs, Inc.). The cell pellet was lysed by alternating freeze thaw cycles in ethanol/dry ice bath three times ...
-
bioRxiv - Bioengineering 2024Quote: ... to generate AAV2 and AAVDJ using keratinocyte-targeting variants [10][12] in pXR2 (encoding AAV2 Rep-Cap) and pAAVDJ plasmids (Cell Biolabs, Inc., San Diego, CA), respectively.
-
bioRxiv - Microbiology 2024Quote: Protein carbonylation was quantified using the OxiSelect Protein Carbonyl ELISA kit (Cell Biolabs; San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Oxidized deoxyguanosine (8-oxo-dG)) was quantified using the OxiSelect Oxidative DNA Damage ELISA kit (Cell Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... liver tissue was minced and bathed in homogenization buffer from Cell Biolabs Inc ...
-
bioRxiv - Immunology 2024Quote: The Platinum-E retroviral packaging cell line (Cell Biolabs) was cultured in standard DMEM (Gibco ...
-
bioRxiv - Bioengineering 2024Quote: AAVs were prepared using 293AAV cells (Cell Biolabs, Inc.) as described previously [2] [16] with minor modifications (calcium phosphate transfection followed by CsCl gradient purification) ...
-
bioRxiv - Microbiology 2024Quote: Neutrophil chemotaxis was assessed using a Boyden chamber fluorometric assay (Cell Biolabs, San Diego, CA). To generate the cell culture supernatants used in this assay ...
-
bioRxiv - Developmental Biology 2024Quote: ... using the CytoSelect 96-Well Cell Migration Assay (Cell Biolabs) after 60 minutes at 37°C for in 5% CO2 cell culture incubator ...
-
bioRxiv - Physiology 2024Quote: ... The cAMP abundance in the carotid bodies was measured using a cAMP ELISA kit (STA-501, Cell Biolabs, Inc., San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Virus yields were then determined by p30 (CA) ELISA using the QuickTiter MuLV Core Antigen Elisa Kit (Cell Biolabs INC, VPK-156) as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: MDA-MB-231 GFP+ and MDA-MB-231 Luciferase-2A-RFP+ cells were purchased from Cell Biolabs and GenTarget ...
-
bioRxiv - Immunology 2024Quote: ... Retrovirus was packaged using Plat-A cells (Cell Biolabs # RV-102). Fas deficient RapoC2 Jurkat cells were previously described 85 ...
-
bioRxiv - Cancer Biology 2024Quote: Total serum calcium was measured using a colorimetric calcium assay kit (Cell Biolabs, MET-5121) as per the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: Lipid rafts were assayed for total cholesterol (Cell Biolabs, San Diego, CA). Tissue hemoglobin or heme quantified by Quantichrom assay (BioAssay Systems ...
-
bioRxiv - Synthetic Biology 2024Quote: ... serial dilutions of eGFP (purchased from Cell Biolabs) were performed in 1x PBS ...
-
bioRxiv - Immunology 2024Quote: ... minced tumor was lysed using RIPA buffer containing protease inhibitor (Cell Biolabs) on ice for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: Protein lysates were generated using RIPA buffer containing protease inhibitor (Cell Biolabs) on ice for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... active viral particles were purified using Pure VirusTM Adenovirus Purification Kit (Cell Biolabs, San Diego ...
-
bioRxiv - Cancer Biology 2024Quote: ... a Taurine Assay Kit (Cell Biolabs, Inc.) was used ...
-
bioRxiv - Cell Biology 2024Quote: ... and lysates were probed with antibodies directed at 4-HNE (STA-035, Cell Biolabs), GPX4 (MAB5457-SP ...
-
bioRxiv - Synthetic Biology 2024Quote: 293AAV cells (Cell Biolabs) and 293FT cells (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Short hairpin RNA (shRNA) against Syt7 sequence (GATCTACCTGTCCTGGAAGAG) was expressed under the control of an U6 promoter of pAAV-U6-GFP vector (Cell Biolabs, #VPK-413). This shRNA was shown to effectively knockdown Syt7 in cell cultures and in vivo by previous reports from more than one research group (Bacaj et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Viral titers were assessed using p24 ELISA (Cell Biolabs, San Diego, Cat#VPK-107).
-
bioRxiv - Molecular Biology 2024Quote: hAPC were seeded in 60 mm or 100 mm culture dishes and transduced with lentivirus using the lentivirus viraductin kit from Cell Biolabs. Lentivirus used in the experiments were produced by HEK239T cells (ATCC ...
-
bioRxiv - Molecular Biology 2024Quote: ... was assessed using a collagen gel-based assay kit (CBA-201, Cell Biolabs, San Diego, CA), as previously described.21,22
-
bioRxiv - Neuroscience 2024Quote: ... pAAV Helper (Cell Biolabs), pAAV2/2 (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCMV-Eco (Cell Biolabs) envelope plasmids using polyethylenimine (PEI ...
-
bioRxiv - Molecular Biology 2024Quote: Serum cholesterol levels in fasting mice were determined using a colorimetric assay (Cell Biolabs, catalog #STA-384). Blood pressure in mice was obtained using the CODA® non-invasive blood pressure system (Kent Scientific Corporation ...
-
bioRxiv - Neuroscience 2024Quote: FA levels in plasma samples were quantified using the FA ELISA Assay kit (Cell Biolabs, cat# MET-5068). Initially ...
-
bioRxiv - Physiology 2024Quote: The levels of 3-Nitrotyrosine were measured with commercially available ELISA assay kits in plasma samples from control or HFpEF patients (#STA-305, Cell Biolabs, San Diego, CA), and from control or HFpEF rodent models (#NBP2-66363 ...
-
bioRxiv - Bioengineering 2024Quote: Cas9 from lyzed EDVs were measured by ELISA and validated against purified Cas9 from commercial (IDT, Cell Biolabs) and in-house sources (UC-Berkeley ...
-
bioRxiv - Bioengineering 2024Quote: ... The amount of Cas9 in the samples was determined by comparison to serial dilution to a cas9 standard (Cell Biolabs Inc.). The amount of p24 was determined by comparison to serial dilution to a p24 standard (Takara Biosciences) ...
-
bioRxiv - Bioengineering 2024Quote: The Cas9 ELISA kit (Cell BioLabs Inc.) and lenti-X p24 Rapid titer kit (Takara Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... MLECs were treated with adenoviral Cre (Cell Biolabs) or 4-hydroxy-tamoxifen (4-OHT ...
-
bioRxiv - Immunology 2024Quote: Mouse B3gnt5 was cloned into a pMX-puro plasmid (Cell Biolabs, supporting table I-a). For virus production ...
-
bioRxiv - Immunology 2024Quote: A pMXs-Puro vector (Cell Biolabs) was equipped with an RFP tag into the multiple cloning site17 ...
-
bioRxiv - Immunology 2024Quote: ... The virus was produced with Plat-E cells (Cell Biolabs RV-101) and transfected with 20µg of MMLV DNA ...
-
bioRxiv - Immunology 2024Quote: ... where number of particles was quantified based on p30 ng/mL determined by MuLV Core Antigen ELISA (Cell Biolabs). Across all three replicate experiments ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T/17 cells were co-transfected with either pssAAV_PDCD1cr3.HDRT-tCD19 or pssAAV_PDCD1cr3.HDRT-IL10tCD19 and a mixture of pHelper and pAAV6-Rep-Cap (both from Cell Biolabs) using calcium phosphate ...
-
bioRxiv - Systems Biology 2024Quote: ... Tyrosine was quantified with a colorimetric kit (Cell Biolabs, #MET5073), phenylalanine was quantified with a fluorometric kit (bioAssay Systems ...
-
bioRxiv - Immunology 2024Quote: ... or 0.2X DCFH-DA (CELL BIOLABS) for 1 hour ...