Labshake search
Citations for Lucigen :
1 - 50 of 744 citations for hsa mir 373 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... GG-pre-miR-19a and pre-miR-143 were generated by overlap-extension (OE) polymerase chain reaction (PCR) using EconoTaq PLUS 2x Master Mix (Lucigen) with primers listed in Table S1 ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was carried out with EconoTaq PLUS GREEN 2X Master Mix (cat# 30033-1; Lucigen) and an initial denaturation at 94°C for 2 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) Shotgun PCR-free library preparation kit (Lucigen) or (iii ...
-
bioRxiv - Developmental Biology 2021Quote: Founder mice were genotyped using FailSafe PCR Kit (EpiCentre) and run on a 12% polyacrylamide gel for heteroduplex assay ...
-
bioRxiv - Cell Biology 2021Quote: ... We used EpiScript RT (Epicentre) to assess U2-Am30 semi-quantitatively ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Molecular Biology 2022Quote: ... An aliquot of 1 μg purified RNA was applied to RT-qPCR and the remaining was subjected to ribosomal RNA depletion using a Ribo-Zero Gold Kit (Epicentre). Sequencing libraries were constructed from 100 ng total RNA using a Truseq stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2019Quote: ... The PCR products were sub-cloned into pGCBlue (Lucigen, pGCBlue Cloning and Amplification kit) or pMiniT (NEB PCR cloning kit ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR fragments were then in vitro transcribed using the AmpliScribe T7-Flash kit (Lucigen) with overnight incubation at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... for qRT-PCR and northern blotting and MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen) for RNA-seq ...
-
bioRxiv - Genetics 2020Quote: ... for qRT-PCR and northern blotting and MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen) for RNA-seq ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the RT product was circularized by CircLigase II (Epicentre). A PCR library was amplified and sequenced using Illumina Nextseq 500 at the Rockefeller University Genomics Center.
-
bioRxiv - Molecular Biology 2020Quote: ... and gel-purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described in (Ingolia et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gel-purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described in (Ingolia et al. ...
-
bioRxiv - Genomics 2023Quote: ... and gel- purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described36 and libraries constructed using a different reverse indexing primer for each sample.
-
bioRxiv - Genetics 2020Quote: ... PCR was performed using EconoTaq and associated PCR reagents (Lucigen) with 4 μL of crude DNA lysate created as described previously 24 from ear punch biopsy specimens of 8 to 14-day-old mice ...
-
bioRxiv - Biochemistry 2021Quote: ... Linear PCR products were ligated by blunt-end ligation using the Fast-link DNA ligation kits from Epicentre. 5μl of the ligation reaction were used for the transformation of chemically-competent E ...
-
bioRxiv - Bioengineering 2023Quote: ... a PCR-amplified NLuc gene block was transcribed using AmpliScribe™ T7-Flash Transcription Kit (Lucigen, ASF-3507) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genotyping PCR was performed using Failsafe PCR 2x PreMix H (Lucigen) and Taq polymerase (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... a PCR-free library was prepared with the NxSeq® AmpFREE Low DNA Library Kit (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNA was generated with EpiScript RT enzyme (Lucigen, 50C for 30 minutes) followed by reaction clean up with exonuclease I (Lucigen ...
-
bioRxiv - Microbiology 2022Quote: ... DNA-Seq library preparation and sequencing were performed by the Genome Quebec Company (Genome Quebec Innovation Center, McGill University, Montreal, Canada) using the Shotgun PCR-free library preparation kit (Lucigen) and the NovaSeq™ 6000 Sequencing system (Illumina® ...
-
bioRxiv - Molecular Biology 2021Quote: ... or XhoI- (for plasmids with the prefix “pUC57-”) digested plasmids or PCR products using the AmpliScribe T7 High Yield Transcription Kit (Lucigen), followed by capping with ScriptCap m7G Capping System (Cell Script) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using gene specific primers and EconoTaq PCR Master Mix (Lucigen) per the manufacturer’s guidelines (18 cycles for S14 and 24 cycles for U6) ...
-
bioRxiv - Genetics 2020Quote: ... Purified PCR products were then used as templates for in vitro transcription per AmpliScribe T7 High Yield Transcription Kit (Epicentre Technologies) specifications to obtain dsRNAs.
-
bioRxiv - Microbiology 2020Quote: ... PCR-free library preparation (Lucigen) and NextSeq 500 sequencing (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were amplified with 10 PCR cycles using the FailSafe PCR enzyme (Illumina/Epicentre). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Genomics 2019Quote: ... 1 μL Reverse PCR Primer (Epicentre), 1 ng of cDNA library ...
-
bioRxiv - Molecular Biology 2019Quote: ... The dsRNAs of target genes were synthesized from the purified PCR products using AmpliScribe T7-Flash Transcription Kit (Epicentre Technologies, Co., Wisconsin, USA).
-
bioRxiv - Cell Biology 2021Quote: ... 20 ng of each sample were PCR amplified using the FailSafe PCR system with PreMix H (Lucigen). Southern blot-based detection of telomere PCR products was modified from previous protocols 48,49 ...
-
bioRxiv - Microbiology 2022Quote: ... was performed in a two-step barcoded PCR protocol using the FailSafe PCR PreMix (Lucigen, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Standard PCRs were performed using StartWarm HS-PCR Mix (A&A Biotechnology) or EconoTaq PLUS2X Master Mix (Lucigen). PCR products were analyzed with 1.5% agarose gel containing GelRed (Biotium ...
-
bioRxiv - Genomics 2019Quote: ... 1 μL ScriptSeq Index PCR Primer (Epicentre), 1 μL Reverse PCR Primer (Epicentre) ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S], 0.5 µL Lucigen NxGen RNase Inhibitor [Lucigen #30281–1] ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the subsequent PCR the Econo-Taq (Lucigen) master mix was used with forward (5’-TGACTATCCTAGAAATCGCTGTCG ...
-
bioRxiv - Biochemistry 2020Quote: ... The standard PCR reaction was performed with the HNqPCRrev1 and HNqPCRfrw1 primers using the Failsafe PCR system with the Premix A (Lucigen, catalog # F599100). Positive and negative PCR control reactions with or without 50ng of HNDNA ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Molecular Biology 2020Quote: ... Comparable results to commercial RNA extraction kits have been obtained using a 5-min direct detection preparation method of nasopharyngeal samples following 1:1 dilution with the Quick Extract DNA extraction Solution (Lucigen) (6) ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR product was in vitro transcribed (Epicentre, ASF3507) under the control of promoter T7 for 12 hours at 37°C and DNAse treated with TURBO-DNAse for 20 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe®PCR Enzyme Mix (Epicentre, Madison, WI, USA) and ScriptSeq®Index PCR Primers (Epicentre ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complete cDNAs were sequence-amplified by PCR using KOD One™ PCR Master Mix -Blue- (TOYOBO, Japan) and were cloned into pSMART-LCK plasmid (Lucigen, Middleton, WI, USA) containing a T7 RNA polymerase promoter ...
-
bioRxiv - Plant Biology 2021Quote: ... which were indexed using ScriptSeq Index PCR Primers (RSBC10948, Epicentre). Sequencing was performed on an Illumina HiSeq instrument (Microgen ...
-
bioRxiv - Plant Biology 2021Quote: ... 6.5 ul FailSafe™ PCR 2X PreMix J (Lucigen, Middleton), 0.5 ul Taq DNA polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Microbiology 2024Quote: ... and ScriptSeq®Index PCR Primers (Epicentre, Madison, WI, USA) for amplification and barcoding of di-tagged cDNA ...
-
bioRxiv - Neuroscience 2022Quote: ... Offspring genotypes were confirmed by PCR (Lucigen EconoTaq Plus GREEN 2X) and both heterozygous and homozygous ChAT-cre/jRGECO1a mice were used in the experiments and no phenotypic difference were observed.
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were then in vitro transcribed with T7 polymerase (Lucigen). Capture SELEX was then carried out as follows ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Colony PCR was performed as follows: 2X EconoTaq Master mix (Lucigen) was used in 20 µL PCR reactions consisting of 10µL of 2X EconoTaq Master mix (Lucigen) ...