Labshake search
Citations for Lucigen :
1 - 50 of 96 citations for hsa mir 30b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The WT NPSL2 DNA template was amplified via polymerase chain reaction (PCR) using a set of four primers (Table S4) with EconoTaq PLUS 2x Master Mix (Lucigen). All the primers were ordered from Integrated DNA Technologies ...
-
bioRxiv - Genomics 2019Quote: ... 1 μL Reverse PCR Primer (Epicentre), 1 ng of cDNA library ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... 1 μL ScriptSeq Index PCR Primer (Epicentre), 1 μL Reverse PCR Primer (Epicentre) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using gene specific primers and EconoTaq PCR Master Mix (Lucigen) per the manufacturer’s guidelines (18 cycles for S14 and 24 cycles for U6) ...
-
bioRxiv - Plant Biology 2021Quote: ... which were indexed using ScriptSeq Index PCR Primers (RSBC10948, Epicentre). Sequencing was performed on an Illumina HiSeq instrument (Microgen ...
-
bioRxiv - Microbiology 2024Quote: ... and ScriptSeq®Index PCR Primers (Epicentre, Madison, WI, USA) for amplification and barcoding of di-tagged cDNA ...
-
bioRxiv - Biochemistry 2024Quote: ... GG-pre-miR-19a and pre-miR-143 were generated by overlap-extension (OE) polymerase chain reaction (PCR) using EconoTaq PLUS 2x Master Mix (Lucigen) with primers listed in Table S1 ...
-
bioRxiv - Neuroscience 2020Quote: ... using Inpp5e WT forward primer 5’-GAGAAGCTGATAGATGGCTAGG and Inpp5e WT reverse primer 5’-AACCAGAAGACCTCATCAAACC and EconoTaq PCR according to manufactures specifications (Lucigen corporation, WI) (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... beads and multiplexed by using ScriptSeq Index PCR Primers (Epicentre, Illumina, Madison, WI USA). cDNA libraries were quantified by using KAPA Illumina Library Quantification kit (KAPA Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... The standard PCR reaction was performed with the HNqPCRrev1 and HNqPCRfrw1 primers using the Failsafe PCR system with the Premix A (Lucigen, catalog # F599100). Positive and negative PCR control reactions with or without 50ng of HNDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was carried out with EconoTaq PLUS GREEN 2X Master Mix (cat# 30033-1; Lucigen) and an initial denaturation at 94°C for 2 min ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... We used EpiScript RT (Epicentre) to assess U2-Am30 semi-quantitatively ...
-
bioRxiv - Microbiology 2020Quote: ... reactions were set up by adding 0.5 uL of RNaseR (Lucigen), 2.5 uL of RNase R buffer and 2 uL of water to the previous set ups (ligated RNA) ...
-
bioRxiv - Plant Biology 2019Quote: ... using random primers and then treated with CircLigase (Epicentre). Circular cDNA was used as template for PCR with a pair of primers shown in Fig 1D (red primer ...
-
bioRxiv - Microbiology 2022Quote: ... (Amsterdam, The Netherlands) using standard pCC2FOS sequencing primers (Epicentre). Non-redundant fosmids were selected ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the RT product was circularized by CircLigase II (Epicentre). A PCR library was amplified and sequenced using Illumina Nextseq 500 at the Rockefeller University Genomics Center.
-
bioRxiv - Molecular Biology 2020Quote: ... and gel-purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described in (Ingolia et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... and gel-purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described in (Ingolia et al. ...
-
bioRxiv - Genomics 2023Quote: ... and gel- purified RT products circularized using CircLigase II (Lucigen, CL4115K). rRNA depletion was performed using biotinylated oligos as described36 and libraries constructed using a different reverse indexing primer for each sample.
-
bioRxiv - Genetics 2020Quote: ... PCR was performed using EconoTaq and associated PCR reagents (Lucigen) with 4 μL of crude DNA lysate created as described previously 24 from ear punch biopsy specimens of 8 to 14-day-old mice ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genotyping PCR was performed using Failsafe PCR 2x PreMix H (Lucigen) and Taq polymerase (NEB).
-
bioRxiv - Cancer Biology 2019Quote: ... one set of the duplicated plates was used for genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen). 1-2μl of extracted genomic DNA in a total PCR reaction volume of 25μl were amplified in a 35 cycle PCR using a locus-specific primer set (primer set 1 ...
-
bioRxiv - Genomics 2023Quote: ... The MDA reactions were prepared using RepliPHI Phi29 DNA polymerase and Reagent set (Epicentre, Illumina, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cDNA was generated with EpiScript RT enzyme (Lucigen, 50C for 30 minutes) followed by reaction clean up with exonuclease I (Lucigen ...
-
bioRxiv - Microbiology 2020Quote: ... PCR-free library preparation (Lucigen) and NextSeq 500 sequencing (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were amplified with 10 PCR cycles using the FailSafe PCR enzyme (Illumina/Epicentre). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Cell Biology 2021Quote: ... 20 ng of each sample were PCR amplified using the FailSafe PCR system with PreMix H (Lucigen). Southern blot-based detection of telomere PCR products was modified from previous protocols 48,49 ...
-
bioRxiv - Microbiology 2022Quote: ... was performed in a two-step barcoded PCR protocol using the FailSafe PCR PreMix (Lucigen, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Molecular Biology 2023Quote: ... Standard PCRs were performed using StartWarm HS-PCR Mix (A&A Biotechnology) or EconoTaq PLUS2X Master Mix (Lucigen). PCR products were analyzed with 1.5% agarose gel containing GelRed (Biotium ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S], 0.5 µL Lucigen NxGen RNase Inhibitor [Lucigen #30281–1] ...
-
bioRxiv - Cancer Biology 2021Quote: ... These primers were used to amplify cell pools after DNA extraction using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050). Amplified reads were sequenced on either an Illumina MiSeq or Illumina HiSeq 2500.
-
bioRxiv - Molecular Biology 2021Quote: ... For the subsequent PCR the Econo-Taq (Lucigen) master mix was used with forward (5’-TGACTATCCTAGAAATCGCTGTCG ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) Shotgun PCR-free library preparation kit (Lucigen) or (iii ...
-
bioRxiv - Microbiology 2020Quote: ... Positive clones that were capable of producing hydroxylamine and nitrite from ammonium were screened and sequenced using specific pCC2FOS sequencing primers (Epicentre) at SinoGenoMax (Beijing ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... bromii strain L2-63 and the constructs for Sas6 without the signal peptide were amplified using the primers listed in Table S1 with overhangs complementary to the Expresso T7 Cloning & Expression System N-His pETite vector (Lucigen). The forward primers were engineered to include the 6x His sequence that complemented the vector plus a TEV protease recognition site for later tag removal ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and primers outlined in Table S1. E. coli colony PCRs (Fig. 1F and Fig. S1F- H) were performed with CloneID 1X Colony PCR Mix (Lucigen 30059-2) and primers outlined in Table S1.
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: ... An aliquot of 1 μg purified RNA was applied to RT-qPCR and the remaining was subjected to ribosomal RNA depletion using a Ribo-Zero Gold Kit (Epicentre). Sequencing libraries were constructed from 100 ng total RNA using a Truseq stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: Founder mice were genotyped using FailSafe PCR Kit (EpiCentre) and run on a 12% polyacrylamide gel for heteroduplex assay ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR product was in vitro transcribed (Epicentre, ASF3507) under the control of promoter T7 for 12 hours at 37°C and DNAse treated with TURBO-DNAse for 20 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... FailSafe®PCR Enzyme Mix (Epicentre, Madison, WI, USA) and ScriptSeq®Index PCR Primers (Epicentre ...
-
bioRxiv - Genomics 2020Quote: ... clones were genotyped using PCR primers outside of the gRNA targeted region (Table S6) to identify clones homozygous for the mariner deletion (DNA QuickExtract Lucigen #QE09050). Clones passing initial genotyping were then further expanded ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complete cDNAs were sequence-amplified by PCR using KOD One™ PCR Master Mix -Blue- (TOYOBO, Japan) and were cloned into pSMART-LCK plasmid (Lucigen, Middleton, WI, USA) containing a T7 RNA polymerase promoter ...
-
bioRxiv - Plant Biology 2021Quote: ... 6.5 ul FailSafe™ PCR 2X PreMix J (Lucigen, Middleton), 0.5 ul Taq DNA polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...