Labshake search
Citations for Lucigen :
51 - 100 of 188 citations for Yeast Extracts since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... total RNA was extracted with a MasterPure Yeast RNA Purification kit (Epicentre) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA-Seq libraries were prepared using Scriptseq Complete Gold Yeast Kit (Epicentre). Ribo-Seq libraries were prepared essentially as per Ingolia and colleagues (18 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and DNA was extracted with a MasterPure Yeast DNA Purification Kit (Lucigen). Unmethylated cytosines were then deaminated to uracil and indexed libraries were prepared using the NEBNext Enzymatic Methyl-seq Kit (NEB #E7120 ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was extracted with the MasterPure Yeast DNA Purification Kit (Lucigen) and DNA concentrations were measured using the Qubit Flex fluorometer and 1x HS dsDNA assay kit (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA was extracted using the MasterPure Yeast DNA purification kit (Epicentre, MPY80200), and concentrations were measured by Qubit ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted using the MasterPure Yeast RNA Purification Kit (Lucigen). First strand cDNA synthesis was performed using the EasyScript Plus cDNA Synthesis Kit (Lamda Biotech ...
-
bioRxiv - Genomics 2022Quote: ... genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre). An Illumina sequencing library was prepared using home-made Tn5 transposase as previously described (Tao et al ...
-
bioRxiv - Genetics 2024Quote: ... Genomic DNA was extracted using MasterPure yeast DNA purification kit (Lucigen MPY80200). A DNA fragment containing a gRNA with the tracrRNA scaffold sequence ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated using the MasterPure Yeast RNA Purification Kit (Epicentre). cDNA was synthesized using the PrimeScript RT Master Mix (Takara).
-
bioRxiv - Cell Biology 2024Quote: RNA extraction was performed using the MasterPure Yeast RNA purification kit (Lucigen) from samples treated as indicated in the legend of Figure S1 ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... whereas organoid samples were directly added to Quick Extract (Lucigen), and vortexed ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted using the Masterpure Yeast RNA extraction kit (Lucigen MPY03100) as per the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted using the MasterPure™ Yeast DNA Purification Kit (Epicentre MPY80200), with slight modifications compared to the manufacturer’s guidelines as follows ...
-
bioRxiv - Systems Biology 2021Quote: ... DNA was extracted from all samples using MasterPure Yeast DNA Purification Kit (Lucigen).
-
bioRxiv - Cell Biology 2020Quote: ... genomic DNA was isolated with the MasterPure™ Yeast DNA Purification Kit (Lucigen) and submitted to GENEWIZ for whole-genome sequencing ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RNA was purified using the MasterPure™ Yeast RNA Purification Kit from Epicentre. cDNA was synthesized with random hexamer primers using SuperScript® IV reverse transcriptase ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was prepared using MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was prepared using MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen) according to manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted using the MasterPure Yeast DNA Purification Kit (Epicentre, UK). During the extraction protocol ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed using to MasterPure Yeast RNA Purification kit protocol (Epicentre) according to manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted using the MasterPure™ Yeast DNA Purification Kit (Epicentre MPY80200) with slight modifications compared to the manufacturer’s guidelines as follows ...
-
bioRxiv - Genetics 2023Quote: Total RNA was isolated using the MasterPure™ Yeast RNA purification kit (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... genomic DNA was extracted from cells using Quick Extract (Lucigen, QE09050) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100,000 iPSCs were taken for DNA extraction using Quick Extract (Lucigen), whereas organoid samples were directly added to Quick Extract (Lucigen) ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were incubated for 72h and harvested with Quick Extract (Lucigen). Genomic DNA was amplified using genomic region-specific primers (Supplemental) ...
-
bioRxiv - Genetics 2023Quote: ... Cell pellets were resuspended in 50 µL of Quick Extract (Lucigen), and genomic DNA was prepared per the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were incubated for 72h and harvested with Quick Extract (Lucigen). Genomic DNA was amplified and sequenced as described above.
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted using Epicentre MasterPure Yeast RNA Purification kit (Epicentre, Madison, WI, USA) and stored in RNase-free TE buffer ...
-
bioRxiv - Genetics 2020Quote: ... The genomic DNA extracted using MasterPure Yeast DNA Purification Kit (tebu-bio: now Lucigen) was sequenced using Illumina HiSeq 2000 technology with 100 bp paired-end libraries ...
-
bioRxiv - Microbiology 2021Quote: ... and RNA was isolated with the MasterPure™ Yeast RNA Purication Kit (Epicentre MPY03100). For RNA sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were harvested and RNA extracted with MasterPure™ Yeast RNA Purification Kit (Epicentre). Samples were vacuum dried and sent to Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was prepared using the MasterPure™ Yeast DNA purification kit from Lucigen. To determine the MAT ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA was extracted using a MasterPure™ Yeast RNA Purification Kit (Lucigen MPY03100), the RNA concentration was determined on a Nanodrop 2000C (Thermo Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... respectively) had their total genomic DNA extracted using MasterPure Yeast DNA Purification Kit (Lucigen), with cell lysis solutions and RNAse A treatment volumes scaled up 4x to adequately lyse all cells and remove RNA ...
-
bioRxiv - Microbiology 2022Quote: ... Preparation of genomic DNA used the MasterPure™ Yeast DNA Purification Kit (Lucigen # MPY80200) with a NextSeq500– 1flowcell mid output (130M fragments) ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted using Epicentre MasterPure yeast RNA purification kit (Epicentre, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted using Epicentre MasterPure yeast RNA purification kit (Epicentre, Madison, WI) according to manufacturer’s instructions and stored in RNase-free Tris-EDTA buffer ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using Lucigen MasterPure Yeast DNA Purification Kit (Lucigen, Middleton, WI, USA). DNA concentration was measured by bio-spectrophotometer absorbance readings and diluted to desired target concentrations.
-
bioRxiv - Genetics 2024Quote: ... Total DNA was purified using Epicentre Masterpure™ Yeast DNA Purification Kit (Lucigen, USA) and resuspended in 50 µL of RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... washed with PBS and resuspended in 200 μL of Quick Extract (Lucigen) lysis buffer and cells were lysed according to the manufacture’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... approximately 30,000 cells were lysed in 25ul Quick Extract Buffer (Lucigen #QE09050), according to the manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and genomic DNA was isolated using a Quick-Extract Buffer (Lucigen GE09050). Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S) ...
-
bioRxiv - Bioengineering 2024Quote: ... with final resuspension into 30 µl of Quick Extract™ reagent (Lucigen). For mutagenesis analysis ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA extraction was performed using the MasterPure Yeast DNA Purification Kit (Epicentre, United States) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from pelleted cells using a MasterPure Yeast RNA extraction kit (Lucigen, MPY03100), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... and RNA was extracted from each replicate using the MasterPure Yeast RNA Purification Kit (Epicentre). Integrity ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA was extracted using the MasterPure yeast DNA purification kit (Epicentre Biotechnologies, Madison, WI) according to the manufacturer’s instructions.