Labshake search
Citations for Lucigen :
1 - 50 of 115 citations for Western Blot Strip It Buffer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Genetics 2020Quote: ... using their associated buffers or alternatively FailSafe PCR PreMix buffers (Epicentre). Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: buffer supplied from Epicentre in the AmpliScribe T7 High Yield Transcription Kit.
-
bioRxiv - Developmental Biology 2021Quote: ... or Buffer J (EpiCentre) with Taq Polymerase (Roche).
-
bioRxiv - Neuroscience 2022Quote: ... 1× transcription buffer (Epicentre Technologies), 125 μCi of 35S-labeled UTP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Failsafe Buffer D (Epicentre). PCR products were run on a 1% agarose gel and imaged using a Gel Doc XR+ (Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... and 1.5× ampligase buffer (Lucigen). The initial denaturation at 94°C for 5 minutes was followed by ramping down to 60°C (−0.1°C/s ...
-
bioRxiv - Microbiology 2020Quote: ... 2 µl TEX reaction buffer (Lucigen) and 0.5 µl RiboGuard RNase Inhibitor (Lucigen ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of recovery buffer (Lucigen) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... PAP dedicated buffer and PAP (Lucigen) from 0.05 to 0.2 U/μL reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... and Failsafe buffer J (Epicentre Biotechnologies) at a final concentration of 1X ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1× CircLigase II buffer (Lucigen, CL9021K), and 2.5 mM MnCl2 was added to 16 µL of cDNA and incubated at 60°C for 100 min followed by 80°C for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and FailSafe™ Buffer J (Epicentre) and resolved on a 1% agarose TBE gel.
-
bioRxiv - Cell Biology 2021Quote: ... Samples were lysed with 1 ml mammalian lysis buffer containing 200 µl 5x Mammalian Polysome Buffer (Epicentre, RPHMR12126), 100 µl 10% Triton X-100 ...
-
bioRxiv - Bioengineering 2019Quote: ... and 1 μL 10X ampligase buffer (Lucigen). Circularization was achieved under the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... 10uL 10x OmniAmp buffer (Lucigen, F883707-1), 8uL dNTP (NEB ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 10X transcription buffer (Epicentre Technologies Madison, WI), 3 μL of S-35-labeled UTP ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Ampligase® Reaction Buffer (Lucigen), 10 U Ampligase (Lucigen) ...
-
bioRxiv - Genetics 2022Quote: ... 20uL of Quick Extract buffer (Lucigen QE0905T) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 1× RNase R buffer (#RNR07250; Epicentre) in a 10 µl reaction volume at 37 °C for 10 min followed by heat inactivation at 95 °C for 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... 30 μg of lysate was diluted to 200 μL in polysome buffer (lysis buffer without Triton X-100) and 1.5 μL RNase I was added (Epicentre #N6901K). RNase digestion was carried out at 200 rpm at 37°C for 45 minutes ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: Genomic DNA was extracted with QuickExtract buffer (Lucigen) by adding 30 µL to a single well of a 96-well plate and incubating for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was extracted using QE buffer (Lucigen) and PCR was performed using Q5 polymerase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 1x Ampligase DNA ligase buffer (Epicentre Technologies, Madison, WI), 0.5 μl of 5M Betain (Sigma Aldrich) ...
-
bioRxiv - Genomics 2022Quote: ... and split into 6-well culture for expansion and into lysis buffer for DNA extraction (homemade by GESC, formulation identical to Lucigen Quick-Extract buffer). PCRs were performed with Platinum Superfi II 2x master mix (Thermofisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1x reaction buffer (Epicentre cat no. RT80125K and RG90910K). RNA and random decamer primer were first incubated at 85°C for 3 minutes and then incubated on ice for 2 minutes during which remaining reaction components were added ...
-
bioRxiv - Genomics 2020Quote: ... and then lysed in 100 μl QuickExtract™ Buffer (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and Epicenter Masterpure Yeast DNA Purification buffer (Epicentre, Madison, WI). Cells were bead beat for 5 cycles (1 minute on ...
-
bioRxiv - Plant Biology 2020Quote: ... A mixture consisting of 1 μl 10x Circligase reaction buffer (Epicentre), 0.5 μl 1 mM ATP ...
-
bioRxiv - Developmental Biology 2021Quote: Standard genotyping was performed by DNA extraction with QuickExtract buffer (Lucigen), after ear clipping (pups ...
-
bioRxiv - Genetics 2020Quote: ... Genomic DNA (gDNA) was extracted with QuickExtract buffer (Lucigen, Middleton, USA) by adding 30 μL to a well of a 96-well plate and incubating for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... rinsed once with 1x phi29 polymerase buffer (Lucigen, NxGen kit 30221) in nuclease-free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Genomics 2023Quote: ... 3µl of Ready-Lyse lysozyme (Epicentre, 250U/µl in TES buffer) was added to the 400µl sample suspensions ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... Excess linker was degraded by adding 2 μl 10× RecJ buffer (Lucigen), 1 μl RecJ exonuclease (Lucigen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... approximately 30,000 cells were lysed in 25ul Quick Extract Buffer (Lucigen #QE09050), according to the manufacturer’s directions ...
-
bioRxiv - Developmental Biology 2022Quote: ... and genomic DNA was isolated using a Quick-Extract Buffer (Lucigen GE09050). Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 150 μl ligation mix (1.5X Fast-link ligation buffer (Lucigen, SS000272-D5), 26.7 mM EGTA (bioWorld ...
-
bioRxiv - Bioengineering 2023Quote: ... Ampligase DNA Ligase and 10X Reaction Buffer were purchased from Lucigen (A3202K). 2X GoTaq G2 Hot Start Colorless Master Mix was purchased from Promega (9IM743) ...
-
bioRxiv - Cancer Biology 2020Quote: ... the circularization mixture was combined with 6 μl 10X Plasmid-Safe Buffer (Lucigen), 2 μl Plasmid-Safe Enzyme (Lucigen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were transferred to tubes containing 3uL of lysis buffer (Epicentre, MessageBOOSTER kit), and stored at - 80° ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 10 μl RNase H buffer and 2 μl hybridase thermostable RNase H (Lucigen) preheated to 45° were added ...
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 500 μL of Red blood cell lysis buffer (Lucigen, SS000400-D2) and incubated at room temperature for 5 minutes ...
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli genomic DNA in 15 μL of 1× Ampligase DNA Ligase Buffer (Epicentre) containing 250 ng of unshared E ...
-
bioRxiv - Genomics 2024Quote: ... The gapfill and ligation solution was composed of 1X Ampligase buffer (Lucigen A3210K), 50 nM dNTPs (New England Biolabs N0447L) ...
-
bioRxiv - Bioengineering 2020Quote: ... Biopsies were transferred to 10μL of Epicenter DNA extraction buffer (Lucigen, Palo Alto, CA) and lysed as described above ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were lysed and genomic DNA was extracted using QuickExtract DNA Extraction Buffer (Lucigen) per the manufacturer’s instructions ...