Labshake search
Citations for Lucigen :
51 - 100 of 271 citations for Somatostatin Receptor 1 SSTR1 Rabbit Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were ligated into the pETite vector containing an N-terminal His6 tag (Lucigen) and transformed into HI-Control 10G cells ...
-
bioRxiv - Microbiology 2022Quote: ... It was then purified using the MasterPure Gram Positive DNA purification kit (Lucigen, Middleton, Wisconsin, USA) using the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified linearized DNA was ligated to the JEBPN-DNA linker (Table S6) using Circligase II (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... The purified capped RNA was subjected to 2’-O methylation using ScriptCapTM 2’-O-Methyltransferase (Epicentre) in the presence of cold S-adenosyl methionine (SAM ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed nine electroporations of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... DNA was purified from these cultures using the MasterPure™ Yeast DNA Purification Kit (Epicenter/Lucigen). Purified DNA was used to amplify each TLO gene using a centromeric chromosome arm specific primer (ALO36-48 and ALO60 ...
-
bioRxiv - Neuroscience 2023Quote: ... The ribosomal RNA was removed from the purified RNAs using the Ribo-Zero magnetic kit (Epicentre). The Ribo-seq library was constructed using the ARTseq™ Ribosome Profiling Kit (Epicentre) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three hundred nanograms of purified plasmids were electroporated into 25 µl of Endura electrocompetent cells (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Total 500 ng of non-purified circRNAs were used for RNase R treatment (Lucigen, Cat # RNR07250). The reaction was performed at 37° C for 30 min with 1 x RNase R buffer and 1 µL (“+” ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified ligation product was transformed into 200 µL of electrocompetent TG1 cells (Lucigen, 60000-PQ763-F) followed by addition of 6 mL of recovery medium (Lucigen ...
-
bioRxiv - Molecular Biology 2021Quote: ... We first repaired the purified DNA again using the End-it DNA End-Repair Kit (Lucigen #ER0720) following the manufacturer’s suggested conditions ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from 300 million cells was purified using the Master Pure Yeast DNA Purification kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... mRNAs were purified after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre Biotech., WI). Fluorescently labeled cRNAs derived from these transcripts were used to probe Agilent Mouse V4.0 LncRNA Array containing probes for 22,692 mRNAs (ArrayStar ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al ...
-
bioRxiv - Genomics 2021Quote: ... We performed 9 electroporations in total of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... mRNA was purified from 100 ng of total RNA by using a Ribo-Zero rRNA removal kit (Epicentre) to deplete ribosomal RNA and convert into double-stranded complementary DNA by using an NEBNext mRNA Second Strand Synthesis Module (E6111L) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al. ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA fragments were then blunted and phosphorylated using End-It DNA End-Repair Kit (#ER0720; Epicentre). Part of the repaired pool was set apart for cloning of singlet libraries ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5% SDS) and purified by MasterPure Complete DNA and RNA Purification Kit Bulk Reagents (Epicentre, Madison, WI, USA). RNA was prepared by TRizol according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... the Gibson reaction products were purified by isopropanol precipitation and electroporated into Endura electrocompetent cells (Lucigen, 60242-2). The transformed bacteria were spread onto LB agar plates containing 100 µg/mL ampicillin and incubated overnight at 37℃ ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was purified from total RNA after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ligation product was purified by isopropanol precipitation and then transformed into electrocompetent Escherichia coli (Lucigen, Middleton, WI, USA). Transformed cells were plated on to 15 cm Luria-Bertani (LB ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Three μg of purified DNA were treated with 2 μl of Plasmid-Safe ATP-dependent exonuclease (Epicentre, Madison, USA) at 37°C for 30 minutes and then heat-inactivated by a 30-min incubation at 70°C.
-
bioRxiv - Genomics 2021Quote: ... The bacterial transformation was done in 50 reactions using 2.5 ul of purified eluate and 20 ul of Transformax EC100D pir-116 (Lucigen) by electroporation (Gene Pulser Xcell ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Purified genomic DNA from each individual was used to prepare paired-end libraries (Lucigen Shotgun library preparation, PCR free) and sequenced on an Illumina HiSeq X PE 150 bp platform to 10-20X coverage at the Centre d’ Expertise et de Services ...
-
bioRxiv - Genomics 2023Quote: ... The resulting plasmid libraries were purified and concentrated via SPRI bead cleanup before being transformed into electrocompetent cells (Lucigen Endura ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was subjected to ribosomal RNA depletion using the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... The DNA was prepared and purified by “MasterPure™ Complete DNA and RNA Purification Kit Bulk Reagents” (Epicentre, Wisconsin, USA). The DNA libraries were constructed using the Nextera DNA Flex Library Prep Kit ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 μg of purified RNA was depleted of ribosomal RNA using a Ribo-Zero rRNA Removal Kit - Plant Leaf (Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ligated RNAs were then purified using phenol/chloroform extraction followed by ethanol precipitation and then digested using 10U RNase R from Epicentre as described in the RNase R treatment paragraph ...
-
bioRxiv - Microbiology 2021Quote: ... The vector product was sized and purified from an agarose gel and circularized by end repair/phosphorylation (Lucigen, cat#ER0720) and blunt ended ligation (Lucigen ...
-
bioRxiv - Microbiology 2019Quote: ... and transposomes were prepared by mixing purified transposon DNA with EZ-Tn5 transposase according to the supplier’s instructions (Lucigen Corp). The mixture was incubated at 37°C for 1 h then stored at −20°C before use.
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...
-
bioRxiv - Systems Biology 2023Quote: ... and cloned into the pRDA-550 vector by NEBridge® Golden Gate Assembly Kit (BsmBI-v2) The product from assembly reaction was purified and electroporated into Endura Electrocompetent cells (Lucigen). Transformed bacteria were diluted 1:100 in 2xYT medium containing 100 μg/ml carbenicillin (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... Type 1 restriction inhibitor (1 µl; Epicentre) was added to the plasmid DNA prior to mixing with competent cells ...
-
bioRxiv - Systems Biology 2020Quote: ... Purified RNA (2.5 μg) was used for ribosome depletion using a Ribo-Zero™ Gold Kit (Human/Mouse/Rat) (Epicentre Biotechnologies) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Purified PCR products were then used as templates for in vitro transcription per AmpliScribe T7 High Yield Transcription Kit (Epicentre Technologies) specifications to obtain dsRNAs.
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA from isolates that exhibited uracil auxotrophy was purified using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen). The promoter ...
-
bioRxiv - Genetics 2020Quote: The DNA isolation was performed on the swim up purified sperm using the MasterPure DNA purification kit (Epicentre Biotechnologies, Madison, WI, USA) as previously described [13] ...
-
bioRxiv - Cancer Biology 2021Quote: ... the ligation products were purified by removing the enzymes and transformed into 500 μl of electroporation competent TG1 cells (Lucigen, Middleton, WI) to make the library.
-
bioRxiv - Molecular Biology 2019Quote: ... The dsRNAs of target genes were synthesized from the purified PCR products using AmpliScribe T7-Flash Transcription Kit (Epicentre Technologies, Co., Wisconsin, USA).
-
bioRxiv - Microbiology 2021Quote: ... eDNA was purified from the samples by removing the proteins and RNA using MasterPure Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), and the DNA concentration was measured using NanoVue Plus (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA from the whole mosquito was isolated and purified using the MasterPure™ Gram Positive DNA Purification Kit following the manufacturer’s instructions (Epicentre Biotechnologies, Madison, USA). During DNA extraction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ml of 37 °C Recovery Medium (Lucigen, 80026-1) was added and bacteria were grown in round-bottom tubes for 1 h at 37 °C while shaking at 180 r.p.m ...
-
bioRxiv - Cell Biology 2020Quote: ... ruptured cells were treated with 1 U μl−1 OmniCleave endonuclease (Lucigen) for 15 min at 37°C to release the DNA-bound protein pool ...
-
bioRxiv - Immunology 2022Quote: ... from Lucigen (60810-1), were used in this study ...