Labshake search
Citations for Lucigen :
151 - 200 of 202 citations for Recombinant E. coli LT IIa His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... coli strains DH5α and C41 (DE3) (Lucigen, Middleton, WI) were grown on Luria agar medium at 37 ℃ ...
-
bioRxiv - Immunology 2023Quote: ... coli strain ClearColi BL21(DE3) (Lucigen Corporation, Cat#60810) at 37 °C for 4 hours with 500 μM IPTG after OD600 reached 0.6-0.8 ...
-
bioRxiv - Pathology 2023Quote: ... coli strains DH5α and C41(DE3) (Lucigen, Middleton, WI) were grown on Luria agar medium at 37 ℃ ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant phagmids were electroporated into TG1 cells (Lucigen, USA). A VHH library of 7.3 × 106 individual clones was obtained.
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Genomics 2022Quote: ... Coli cells by electroporation using the manufacturer’s protocol (Lucigen EC300150).
-
bioRxiv - Genomics 2023Quote: ... coli cells by electroporation using the manufacturer’s protocol (Lucigen EC300150).
-
bioRxiv - Biochemistry 2023Quote: ... coli (C41) cells for protein expression were purchased from Lucigen Corporation (Wisconsin) ...
-
bioRxiv - Microbiology 2023Quote: ... and Escherichia coli BAC-Optimized Replicator v2.0 (Lucigen; 60210–1), Streptomyces mirabilis P8-A218 ...
-
bioRxiv - Microbiology 2019Quote: ... amplified and transformed into Hi-Control 10G cells according to manufactures protocol (Lucigen, Expresso™ T7 cloning and expression system) ...
-
bioRxiv - Cell Biology 2023Quote: ... and His-SUMO-N was inserted into the backbone of pETite-HisSUMO (Lucigen) using NEBuilder HiFi DNA Assembly Master Mix kit (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... coli Cloni® 10G cells (Lucigen, USA; 1ul crude reaction mix). Kanamycin selected clones were screened by colony PCR and verified by sequencing ...
-
bioRxiv - Microbiology 2019Quote: Escherichia coli S17-130 and EC100D (Epicentre Technologies, Madison, WI, USA) were cultivated at 37°C in LB).
-
bioRxiv - Microbiology 2020Quote: Escherichia coli TransforMax Epi300 electrocompetent cells (Ref. EC300110, Epicentre, Madison, WI) and Saccharomyces cerevisiae VL6-48N strain [30] were used to propagate the pCC1BAC-His3 containing viral cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... coli cells (Strand et al., 2014; Lucigen, Middleton, WI, Catalog #EC300110) were transformed via heat shock with sequence-verified pPtPBR1 episomes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmid was maintained in 10G elite Escherichia coli bacteria (Lucigen).
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... coli strain DH5α was isolated using the QuickExtract DNA extraction solution (Lucigen). The coding sequences of the four autoinducer-2 exporter genes were amplified using the Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 Star (DE3) or OverExpress C43 (DE3) (Lucigen/VWR, Radnor, PA). Following induction with IPTG ...
-
bioRxiv - Immunology 2019Quote: The recombinant plasmids were transformed into ClearColi-BL21 (DE3) electrocompetent cells (Lucigen) by heat-shock transformation ...
-
bioRxiv - Microbiology 2022Quote: ... was resuspended in TE and introduced into BL21(DE3) Hi-Control chemically competent cells (Lucigen), which were selected on LB plates supplemented with kanamycin.
-
bioRxiv - Synthetic Biology 2020Quote: ... All strains were constructed using Escherichia coli strain C43(DE3) (Lucigen, Madison, WI). The deletion of frdABCD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli genomic DNA in 15 μL of 1× Ampligase DNA Ligase Buffer (Epicentre) containing 250 ng of unshared E ...
-
bioRxiv - Plant Biology 2019Quote: Each ARF DBD was cloned in the pETite N-His SUMO Kan expression vector (Lucigen, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli genomic DNA was purified using the MasterPure Gram Positive DNA Purification Kit (Epicentre). All DNAs were purified again using the Zymo Clean and Concentrator-25 (Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10G isa highly competent DH10B derivative [54] originally obtained from Lucigen (60107-1). E ...
-
bioRxiv - Immunology 2023Quote: The Escherichia coli strains TG1 and AXE688 (21, 22, 23) were purchased from Lucigen Corporation (Middleton ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS encoding FLVA (residues 55-723) was cloned into pETite® C-His Kan Vector (Lucigen) downstream of a sequence for a Strep-tag II (WSHPQFEK ...
-
bioRxiv - Cancer Biology 2022Quote: ... The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen; cat. 60242-2) using a Bio-Rad MicroPulser Electroporator (#1652100) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli 10G is a highly competent DH10B derivative [39] originally obtained from Lucigen (60107-1). E ...
-
bioRxiv - Microbiology 2023Quote: ... These recombinant plasmids were then introduced into BAC-Optimized Replicator v2.0 electrocompetent cells (60210, Lucigen) via electroporation at 2500V ...
-
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Synthetic Biology 2020Quote: Golden gate assembly reactions were transformed into chemically competent Escherichia coli prepared from strain TG1 (Lucigen). Transformed cells were selected on Lysogeny Broth containing the antibiotics chloramphenicol ...
-
bioRxiv - Biophysics 2020Quote: The identified sybody genes of positive clones were chemically-transformed into Escherichia coli MC1061 F- (Lucigen) cells ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed nine electroporations of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Genomics 2019Quote: ... coli RNA that underwent reverse transcription and amplification using the ScriptSeq Complete Gold Kit for Epidemiology (Epicentre).
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Molecular Biology 2022Quote: ... bromii strain L2-63 and the constructs for Sas6 without the signal peptide were amplified using the primers listed in Table S1 with overhangs complementary to the Expresso T7 Cloning & Expression System N-His pETite vector (Lucigen). The forward primers were engineered to include the 6x His sequence that complemented the vector plus a TEV protease recognition site for later tag removal ...
-
bioRxiv - Genomics 2021Quote: ... We performed 9 electroporations in total of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... coli chromosome was carried out by electroporating 1 μL of the EZ-Tn5
Tnp Transposome (Epicentre) in 50 μL of EV18-pkD46 electrocompetent cells ... -
bioRxiv - Biochemistry 2021Quote: ... coli DnaB and mutants (R74A, R164A, K180A, R328/329A) were independently expressed in C41 strain (Lucigen, Middelton, WI) from pET11b-derived plasmids as previously described [4] ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ligation product was purified by isopropanol precipitation and then transformed into electrocompetent Escherichia coli (Lucigen, Middleton, WI, USA). Transformed cells were plated on to 15 cm Luria-Bertani (LB ...
-
bioRxiv - Immunology 2023Quote: The extracellular domains of HLA-G2 (HLA-G2) were expressed in Escherichia coli ClearColi BL21(DE3) competent cells (Lucigen) to avoid triggering endotoxic responses in human cells ...
-
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ProPeL experiments were carried out as previously described8 with the following conditions for in vivo proteome phosphorylation: all CK2 constructs were expressed in Escherichia coli OverExpress C43(DE3) cells (Lucigen) by IPTG induction ...
-
bioRxiv - Immunology 2021Quote: Full-length SARS-CoV-2 and HCoV-OC43 nucleoproteins were produced by expression in Escherichia coli C43(DE3) cells (Lucigen) and purified as previously described (12) ...