Labshake search
Citations for Lucigen :
1 - 50 of 309 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Microbiology 2023Quote: Tn-5 transposon insertion library was build based on EZ-Tn5™
2>Tnp transposome system (Lucigen, WI, USA). Competent C ... -
bioRxiv - Molecular Biology 2019Quote: ... 4 µg RNA was digested with 4 U RNase R (Epicentre) in a total reaction volume of 10 µL for 10 minutes at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2024Quote: ... the 5’PPP structures were removed using RNA 5’ polyphosphatase (Epicentre). Afterwards ...
-
bioRxiv - Immunology 2019Quote: 1ug of total cellular RNA was treated with RNA 5’ polyphosphatase (enzyme that converts 5’-triphosphorylated RNA into 5’-monophosphorylated RNA, Lucigen) for 30 min at 37°C or mock-treated ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µg RNA was incubated with 5 U RNase R (#RNR07250; Epicentre) in 1× RNase R buffer (#RNR07250 ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-deadenylase (Epicentre, DA11101K) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 20 µL circularization reaction mix (7.75 mM Tris pH 8, 1x Epicentre CircLigase buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... expanded by 16 electroporations (8 for each half library) into Endura electrocompetent cells (Lucigen), and plated on sixteen 24.5 cm bioassay plates (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
bioRxiv - Neuroscience 2022Quote: ... coli (Lucigen 60242-2) using program EC1 on MicroPulser Electroporator (Bio-Rad 1652100 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of eluent was then electroporated into each of 2 tubes of 50 uL Endura electrocompetent cells (Lucigen, Cat#60242-2) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 U RecJ exonuclease (Epicentre). Up to 8 libraries were pooled ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: RNA 5’Polyphosphatase (Lucigen, Middleton, USA) was used to generate 5’p-RNA from IVT 5’ppp-RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl RNase R mixture (Epicentre) was added to the sample before incubation at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 U Baseline-ZERO DNase (Epicentre), 25 U Benzonase (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of RNase inhibitor (Lucigen) and 450 μl of IP buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... sequences were designed to remove N-terminal signaling peptides and to add a histidine tag for immobilized metal affinity chromatography (IMAC) (in many cases using the Lucigen MA101-Expresso-T7-Cloning-&-Expression-System) ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... coli (Lucigen, cat. 60242-2) using Bio-Rad MicroPulser Electroporator (cat ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Step 2: Riboshredder RNase (Epicentre) was used in place of RNase A ...
-
bioRxiv - Immunology 2020Quote: ... coli (Lucigen, Cat# 60502-2) over fifty shocks for each library ...
-
bioRxiv - Microbiology 2024Quote: ... 2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... cloni 10G ELITE Electrocompetent Cells (Lucigen 60052-4) in 1mm cuvette (Bio-Rad 1652089 ...
-
bioRxiv - Genetics 2023Quote: ... 4 units of Ampligase® DNA Ligase (Epicentre), 0.2 ul of Ampligase® 10X Reaction Buffer ...