Labshake search
Citations for Lucigen :
51 - 100 of 112 citations for Purified Zika Virus Lysate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The purified total mRNA was treated by 5’-Phosphate-Dependent Exonuclease (Lucigen, TER51020) to degrade RNAs with 5’ monophosphates ...
-
bioRxiv - Genomics 2024Quote: ... The purified library was electroporated in eight replicates into Endura electrocompetent cells (Lucigen), using 50-100 ng/μl DNA and 25 μl cells in 0.1 cm BioRad cuvettes at 1800 V ...
-
bioRxiv - Neuroscience 2020Quote: The RNA isolated from each cell was reverse transcribed and amplified using T7 linear amplification (Epicentre, Message BOOSTER kit for cell lysate), run through RNA Cleaner & Concentrator-5 columns (Zymo Research) ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... The size-selected and purified cDNA was circularized using CircLigase ssDNA ligase kit (Lucigen) following manufacture’s protocol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli genomic DNA was purified using the MasterPure Gram Positive DNA Purification Kit (Epicentre). All DNAs were purified again using the Zymo Clean and Concentrator-25 (Zymo Research ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was purified using MasterPure™ Complete DNA and RNA Purification Kit (Lucigen). Quantitative PCR (qPCR ...
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA was purified using MasterPure™ Complete DNA and RNA Purification Kit (Lucigen). The whole fkbA locus from the FK506 resistant isolates was amplified using primers JOHE52223 and JOHE52224 and LA Taq DNA polymerase for long-range PCR with GC Buffer I (Takara) ...
-
bioRxiv - Genetics 2024Quote: ... Total DNA was purified using Epicentre Masterpure™ Yeast DNA Purification Kit (Lucigen, USA) and resuspended in 50 µL of RNase-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNAs were size-purified on TBE-Urea gels before being circularized by CircLigase II (Epicentre). Circularised cDNAs were then annealed to an oligonucleotide complementary to the BamHI site and then BamHI digested ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from pelleted cells using a MasterPure Yeast RNA extraction kit (Lucigen, MPY03100), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The dsDNA was purified from a 1% agarose gel and electroporated into E.coli SS320 (Lucigen) electrocompetent cells pre-infected with M13KO7 helper-phage (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reverse-transcribed products were then gel-purified and circularized using CircLigase ssDNA Ligase (Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... then further purified by MasterPure Complete DNA and RNA Purification Kit Bulk Reagents (Epicentre, Madison, USA). 100 ng of DNA was used for qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were ligated into the pETite vector containing an N-terminal His6 tag (Lucigen) and transformed into HI-Control 10G cells ...
-
bioRxiv - Microbiology 2022Quote: ... It was then purified using the MasterPure Gram Positive DNA purification kit (Lucigen, Middleton, Wisconsin, USA) using the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified linearized DNA was ligated to the JEBPN-DNA linker (Table S6) using Circligase II (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... The purified capped RNA was subjected to 2’-O methylation using ScriptCapTM 2’-O-Methyltransferase (Epicentre) in the presence of cold S-adenosyl methionine (SAM ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed nine electroporations of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... DNA was purified from these cultures using the MasterPure™ Yeast DNA Purification Kit (Epicenter/Lucigen). Purified DNA was used to amplify each TLO gene using a centromeric chromosome arm specific primer (ALO36-48 and ALO60 ...
-
bioRxiv - Neuroscience 2023Quote: ... The ribosomal RNA was removed from the purified RNAs using the Ribo-Zero magnetic kit (Epicentre). The Ribo-seq library was constructed using the ARTseq™ Ribosome Profiling Kit (Epicentre) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Three hundred nanograms of purified plasmids were electroporated into 25 µl of Endura electrocompetent cells (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Total 500 ng of non-purified circRNAs were used for RNase R treatment (Lucigen, Cat # RNR07250). The reaction was performed at 37° C for 30 min with 1 x RNase R buffer and 1 µL (“+” ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified ligation product was transformed into 200 µL of electrocompetent TG1 cells (Lucigen, 60000-PQ763-F) followed by addition of 6 mL of recovery medium (Lucigen ...
-
bioRxiv - Molecular Biology 2021Quote: ... We first repaired the purified DNA again using the End-it DNA End-Repair Kit (Lucigen #ER0720) following the manufacturer’s suggested conditions ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from 300 million cells was purified using the Master Pure Yeast DNA Purification kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... mRNAs were purified after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre Biotech., WI). Fluorescently labeled cRNAs derived from these transcripts were used to probe Agilent Mouse V4.0 LncRNA Array containing probes for 22,692 mRNAs (ArrayStar ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µg of purified RNA was used in cDNA synthesis with MMLV HP Reverse Transcriptase (Lucigen RT80125K) and 100 ng random hexamers (IDT) ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al ...
-
bioRxiv - Genomics 2021Quote: ... We performed 9 electroporations in total of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... mRNA was purified from 100 ng of total RNA by using a Ribo-Zero rRNA removal kit (Epicentre) to deplete ribosomal RNA and convert into double-stranded complementary DNA by using an NEBNext mRNA Second Strand Synthesis Module (E6111L) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al. ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA fragments were then blunted and phosphorylated using End-It DNA End-Repair Kit (#ER0720; Epicentre). Part of the repaired pool was set apart for cloning of singlet libraries ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5% SDS) and purified by MasterPure Complete DNA and RNA Purification Kit Bulk Reagents (Epicentre, Madison, WI, USA). RNA was prepared by TRizol according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... the Gibson reaction products were purified by isopropanol precipitation and electroporated into Endura electrocompetent cells (Lucigen, 60242-2). The transformed bacteria were spread onto LB agar plates containing 100 µg/mL ampicillin and incubated overnight at 37℃ ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was purified from total RNA after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ligation product was purified by isopropanol precipitation and then transformed into electrocompetent Escherichia coli (Lucigen, Middleton, WI, USA). Transformed cells were plated on to 15 cm Luria-Bertani (LB ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... Three μg of purified DNA were treated with 2 μl of Plasmid-Safe ATP-dependent exonuclease (Epicentre, Madison, USA) at 37°C for 30 minutes and then heat-inactivated by a 30-min incubation at 70°C.
-
bioRxiv - Genomics 2021Quote: ... The bacterial transformation was done in 50 reactions using 2.5 ul of purified eluate and 20 ul of Transformax EC100D pir-116 (Lucigen) by electroporation (Gene Pulser Xcell ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Purified genomic DNA from each individual was used to prepare paired-end libraries (Lucigen Shotgun library preparation, PCR free) and sequenced on an Illumina HiSeq X PE 150 bp platform to 10-20X coverage at the Centre d’ Expertise et de Services ...
-
bioRxiv - Genomics 2023Quote: ... The resulting plasmid libraries were purified and concentrated via SPRI bead cleanup before being transformed into electrocompetent cells (Lucigen Endura ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was subjected to ribosomal RNA depletion using the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Epicentre), according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... The DNA was prepared and purified by “MasterPure™ Complete DNA and RNA Purification Kit Bulk Reagents” (Epicentre, Wisconsin, USA). The DNA libraries were constructed using the Nextera DNA Flex Library Prep Kit ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 μg of purified RNA was depleted of ribosomal RNA using a Ribo-Zero rRNA Removal Kit - Plant Leaf (Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ligated RNAs were then purified using phenol/chloroform extraction followed by ethanol precipitation and then digested using 10U RNase R from Epicentre as described in the RNase R treatment paragraph ...
-
bioRxiv - Microbiology 2021Quote: ... The vector product was sized and purified from an agarose gel and circularized by end repair/phosphorylation (Lucigen, cat#ER0720) and blunt ended ligation (Lucigen ...
-
bioRxiv - Microbiology 2019Quote: ... and transposomes were prepared by mixing purified transposon DNA with EZ-Tn5 transposase according to the supplier’s instructions (Lucigen Corp). The mixture was incubated at 37°C for 1 h then stored at −20°C before use.
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...